APEH/AARE cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51915-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All APEH/AARE Reagents
CRO Services
Product recommended

All APEH/AARE Reagents
APEH/AARE cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2199 bp
Description
Full length Clone DNA of Mouse acylpeptide hydrolase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APEH/AARE Background Information
Full Name
acylaminoacyl-peptide hydrolase

APEH/AARE cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
APEH/AARE cDNA ORF Clone in Cloning Vector, Rat RG81533-G

APEH/AARE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
APEH/AARE cDNA ORF Clone in Cloning Vector, Mouse MG51915-G
APEH/AARE cDNA ORF Clone, Mouse, untagged MG51915-UT
APEH/AARE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51915-ACGLN
APEH/AARE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51915-ACG
APEH/AARE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51915-ANG
APEH/AARE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51915-ACR
APEH/AARE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51915-ANR
APEH/AARE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51915-CF
APEH/AARE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51915-NF
APEH/AARE cDNA ORF Clone, Mouse, C-His tag MG51915-CH
APEH/AARE cDNA ORF Clone, Mouse, N-His tag MG51915-NH
APEH/AARE cDNA ORF Clone, Mouse, C-HA tag MG51915-CY
APEH/AARE cDNA ORF Clone, Mouse, N-HA tag MG51915-NY
APEH/AARE cDNA ORF Clone, Mouse, N-Myc tag MG51915-NM
APEH/AARE qPCR Primer Pairs, Mouse MP201788

APEH/AARE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APEH/AARE cDNA ORF Clone in Cloning Vector, Human HG11303-M
APEH/AARE cDNA ORF Clone, Human, untagged HG11303-UT
APEH/AARE cDNA ORF Clone, Human, C-GFPSpark® tag HG11303-ACG
APEH/AARE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11303-ACGLN
APEH/AARE cDNA ORF Clone, Human, N-GFPSpark® tag HG11303-ANG
APEH/AARE cDNA ORF Clone, Human, C-OFPSpark® tag HG11303-ACR
APEH/AARE cDNA ORF Clone, Human, N-OFPSpark® tag HG11303-ANR
APEH/AARE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11303-CF
APEH/AARE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11303-NF
APEH/AARE cDNA ORF Clone, Human, C-His tag HG11303-CH
APEH/AARE cDNA ORF Clone, Human, N-His tag HG11303-NH
APEH/AARE cDNA ORF Clone, Human, C-HA tag HG11303-CY
APEH/AARE cDNA ORF Clone, Human, N-HA tag HG11303-NY
APEH/AARE cDNA ORF Clone, Human, C-Myc tag HG11303-CM
APEH/AARE cDNA ORF Clone, Human, N-Myc tag HG11303-NM
APEH/AARE qPCR Primer Pairs, Human HP101193
info info
添加购物车成功! 添加购物车失败!