VAP1/AOC3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50676-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VAP1/AOC3 Reagents
CRO Services
Product recommended

All VAP1/AOC3 Reagents
VAP1/AOC3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2298 bp
Description
Full length Clone DNA of Mouse amine oxidase, copper containing 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VAP1/AOC3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
SSAO cDNA ORF Clone, Mouse;VAP1 cDNA ORF Clone, Mouse
VAP1/AOC3 Background Information
Full Name
amine oxidase, copper containing 3

VAP1/AOC3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VAP1/AOC3 cDNA ORF Clone in Cloning Vector, Rat RG81415-G

VAP1/AOC3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VAP1/AOC3 cDNA ORF Clone in Cloning Vector, Mouse MG50676-G
VAP1/AOC3 cDNA ORF Clone, Mouse, untagged MG50676-UT
VAP1/AOC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50676-ACGLN
VAP1/AOC3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50676-ACG
VAP1/AOC3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50676-ACR
VAP1/AOC3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50676-CF
VAP1/AOC3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50676-NF
VAP1/AOC3 cDNA ORF Clone, Mouse, C-His tag MG50676-CH
VAP1/AOC3 cDNA ORF Clone, Mouse, N-His tag MG50676-NH
VAP1/AOC3 cDNA ORF Clone, Mouse, C-HA tag MG50676-CY
VAP1/AOC3 cDNA ORF Clone, Mouse, C-Myc tag MG50676-CM
VAP1/AOC3 cDNA ORF Clone, Mouse, N-Myc tag MG50676-NM
VAP1/AOC3 qPCR Primer Pairs, Mouse MP200655

VAP1/AOC3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VAP1/AOC3 cDNA ORF Clone in Cloning Vector, Human HG12009-G
VAP1/AOC3 cDNA ORF Clone, Human, untagged HG12009-UT
VAP1/AOC3 cDNA ORF Clone, Human, C-GFPSpark® tag HG12009-ACG
VAP1/AOC3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12009-ACGLN
VAP1/AOC3 cDNA ORF Clone, Human, C-OFPSpark® tag HG12009-ACR
VAP1/AOC3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12009-CF
VAP1/AOC3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12009-NF
VAP1/AOC3 cDNA ORF Clone, Human, C-His tag HG12009-CH
VAP1/AOC3 cDNA ORF Clone, Human, N-His tag HG12009-NH
VAP1/AOC3 cDNA ORF Clone, Human, C-HA tag HG12009-CY
VAP1/AOC3 cDNA ORF Clone, Human, N-HA tag HG12009-NY
VAP1/AOC3 cDNA ORF Clone, Human, C-Myc tag HG12009-CM
VAP1/AOC3 cDNA ORF Clone, Human, N-Myc tag HG12009-NM
VAP1/AOC3 qPCR Primer Pairs, Human HP101546
info info
添加购物车成功! 添加购物车失败!