Angiopoietin-1 cDNA ORF Clone, Mouse, untagged

Cat: MG50300-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Angiopoietin-1 Reagents
CRO Services
Product recommended

All Angiopoietin-1 Reagents
Angiopoietin-1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse angiopoietin 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.5kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Angiopoietin-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-1 cDNA ORF Clone, Mouse, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Angiopoietin-1 cDNA ORF Clone, Mouse, untagged Alternative Names
1110046O21Rik cDNA ORF Clone, Mouse;Ang-1 cDNA ORF Clone, Mouse;Ang1 cDNA ORF Clone, Mouse
Angiopoietin-1 Background Information
Full Name
angiopoietin 1

Angiopoietin-1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Angiopoietin-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90025-G
Angiopoietin-1 cDNA ORF Clone, Rhesus, untagged CG90025-UT
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90025-ACG
Angiopoietin-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90025-ACGLN
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90025-ACR
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90025-CF
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90025-NF
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-His tag CG90025-CH
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-His tag CG90025-NH
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-HA tag CG90025-CY
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-HA tag CG90025-NY
Angiopoietin-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90025-CM
Angiopoietin-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90025-NM

Angiopoietin-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Angiopoietin-1 cDNA ORF Clone in Cloning Vector, Mouse MG50300-M
Angiopoietin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50300-ACG
Angiopoietin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50300-ACGLN
Angiopoietin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50300-ACR
Angiopoietin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50300-CF
Angiopoietin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50300-NF
Angiopoietin-1 cDNA ORF Clone, Mouse, C-His tag MG50300-CH
Angiopoietin-1 cDNA ORF Clone, Mouse, N-His tag MG50300-NH
Angiopoietin-1 cDNA ORF Clone, Mouse, C-HA tag MG50300-CY
Angiopoietin-1 cDNA ORF Clone, Mouse, N-HA tag MG50300-NY
Angiopoietin-1 cDNA ORF Clone, Mouse, C-Myc tag MG50300-CM
Angiopoietin-1 cDNA ORF Clone, Mouse, N-Myc tag MG50300-NM
Angiopoietin-1 qPCR Primer Pairs, Mouse MP200323

Angiopoietin-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Angiopoietin-1 cDNA ORF Clone in Cloning Vector, Human HG13667-G
Angiopoietin-1 cDNA ORF Clone, Human, untagged HG13667-UT
Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16506-ACGLN
Angiopoietin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13667-ACGLN
Angiopoietin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13667-ACG
Angiopoietin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13667-ACR
Angiopoietin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13667-CF
Angiopoietin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13667-NF
Angiopoietin-1 cDNA ORF Clone, Human, C-His tag HG16506-CH
Angiopoietin-1 cDNA ORF Clone, Human, C-His tag HG13667-CH
Angiopoietin-1 cDNA ORF Clone, Human, N-His tag HG13667-NH
Angiopoietin-1 cDNA ORF Clone, Human, C-HA tag HG13667-CY
Angiopoietin-1 cDNA ORF Clone, Human, N-HA tag HG13667-NY
Angiopoietin-1 cDNA ORF Clone, Human, C-Myc tag HG13667-CM
Angiopoietin-1 cDNA ORF Clone, Human, N-Myc tag HG13667-NM
Angiopoietin-1 qPCR Primer Pairs, Human HP102347
info info
添加购物车成功! 添加购物车失败!