Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51277-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Apc11/ANAPC11 Reagents
CRO Services
Product recommended

All Apc11/ANAPC11 Reagents
Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
255 bp
Description
Full length Clone DNA of Mouse anaphase promoting complex subunit 11 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-His tag Alternative Names
1110011I19Rik cDNA ORF Clone, Mouse;R75218 cDNA ORF Clone, Mouse
Apc11/ANAPC11 Background Information
Full Name
anaphase promoting complex subunit 11

Apc11/ANAPC11 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Apc11/ANAPC11 cDNA ORF Clone in Cloning Vector, Rat RG80760-U
Apc11/ANAPC11 cDNA ORF Clone, Rat, untagged RG80760-UT
Apc11/ANAPC11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80760-ACGLN
Apc11/ANAPC11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80760-ACG
Apc11/ANAPC11 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80760-ANG
Apc11/ANAPC11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80760-ACR
Apc11/ANAPC11 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80760-ANR
Apc11/ANAPC11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80760-CF
Apc11/ANAPC11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80760-NF
Apc11/ANAPC11 cDNA ORF Clone, Rat, C-His tag RG80760-CH
Apc11/ANAPC11 cDNA ORF Clone, Rat, N-His tag RG80760-NH
Apc11/ANAPC11 cDNA ORF Clone, Rat, C-HA tag RG80760-CY
Apc11/ANAPC11 cDNA ORF Clone, Rat, N-HA tag RG80760-NY
Apc11/ANAPC11 cDNA ORF Clone, Rat, C-Myc tag RG80760-CM
Apc11/ANAPC11 cDNA ORF Clone, Rat, N-Myc tag RG80760-NM
Apc11/ANAPC11 qPCR Primer Pairs, Rat RP300724

Apc11/ANAPC11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Apc11/ANAPC11 cDNA ORF Clone in Cloning Vector, Mouse MG51277-U
Apc11/ANAPC11 cDNA ORF Clone, Mouse, untagged MG51277-UT
Apc11/ANAPC11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51277-ACGLN
Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51277-ACG
Apc11/ANAPC11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51277-ANG
Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51277-ACR
Apc11/ANAPC11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51277-ANR
Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51277-CF
Apc11/ANAPC11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51277-NF
Apc11/ANAPC11 cDNA ORF Clone, Mouse, N-His tag MG51277-NH
Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-HA tag MG51277-CY
Apc11/ANAPC11 cDNA ORF Clone, Mouse, N-HA tag MG51277-NY
Apc11/ANAPC11 cDNA ORF Clone, Mouse, C-Myc tag MG51277-CM
Apc11/ANAPC11 cDNA ORF Clone, Mouse, N-Myc tag MG51277-NM
Apc11/ANAPC11 qPCR Primer Pairs, Mouse MP201159

Apc11/ANAPC11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Apc11/ANAPC11 cDNA ORF Clone, Human, untagged HG19583-UT
info info
添加购物车成功! 添加购物车失败!