AMD1/SAMDC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51920-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AMD1/SAMDC Reagents
CRO Services
Product recommended

All AMD1/SAMDC Reagents
AMD1/SAMDC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Mouse S-adenosylmethionine decarboxylase 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AMD1/SAMDC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1 cDNA ORF Clone, Mouse;AdoMetDC cDNA ORF Clone, Mouse;adoMetDC1 cDNA ORF Clone, Mouse;Amd-1 cDNA ORF Clone, Mouse;SAMDC cDNA ORF Clone, Mouse;SAMDC1 cDNA ORF Clone, Mouse
AMD1/SAMDC Background Information
Full Name
adenosylmethionine decarboxylase 1

AMD1/SAMDC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AMD1/SAMDC cDNA ORF Clone in Cloning Vector, Rat RG83049-U
AMD1/SAMDC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83049-ACGLN

AMD1/SAMDC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AMD1/SAMDC cDNA ORF Clone in Cloning Vector, Mouse MG51920-G
AMD1/SAMDC cDNA ORF Clone, Mouse, untagged MG51920-UT
AMD1/SAMDC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51920-ACG
AMD1/SAMDC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51920-ACGLN
AMD1/SAMDC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51920-ANG
AMD1/SAMDC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51920-ACR
AMD1/SAMDC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51920-ANR
AMD1/SAMDC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51920-CF
AMD1/SAMDC cDNA ORF Clone, Mouse, C-His tag MG51920-CH
AMD1/SAMDC cDNA ORF Clone, Mouse, N-His tag MG51920-NH
AMD1/SAMDC cDNA ORF Clone, Mouse, C-HA tag MG51920-CY
AMD1/SAMDC cDNA ORF Clone, Mouse, N-HA tag MG51920-NY
AMD1/SAMDC cDNA ORF Clone, Mouse, C-Myc tag MG51920-CM
AMD1/SAMDC cDNA ORF Clone, Mouse, N-Myc tag MG51920-NM
AMD1/SAMDC qPCR Primer Pairs, Mouse MP201793

AMD1/SAMDC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AMD1/SAMDC cDNA ORF Clone in Cloning Vector, Human HG11283-M
AMD1/SAMDC cDNA ORF Clone, Human, untagged HG11283-UT
AMD1/SAMDC cDNA ORF Clone, Human, C-GFPSpark® tag HG11283-ACG
AMD1/SAMDC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11283-ACGLN
AMD1/SAMDC cDNA ORF Clone, Human, N-GFPSpark® tag HG11283-ANG
AMD1/SAMDC cDNA ORF Clone, Human, C-OFPSpark® tag HG11283-ACR
AMD1/SAMDC cDNA ORF Clone, Human, N-OFPSpark® tag HG11283-ANR
AMD1/SAMDC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11283-CF
AMD1/SAMDC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11283-NF
AMD1/SAMDC cDNA ORF Clone, Human, C-His tag HG11283-CH
AMD1/SAMDC cDNA ORF Clone, Human, N-His tag HG11283-NH
AMD1/SAMDC cDNA ORF Clone, Human, C-HA tag HG11283-CY
AMD1/SAMDC cDNA ORF Clone, Human, N-HA tag HG11283-NY
AMD1/SAMDC cDNA ORF Clone, Human, C-Myc tag HG11283-CM
AMD1/SAMDC cDNA ORF Clone, Human, N-Myc tag HG11283-NM
AMD1/SAMDC qPCR Primer Pairs, Human HP101161
info info
添加购物车成功! 添加购物车失败!