FLAP cDNA ORF Clone, Mouse, untagged

Cat: MG52815-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FLAP Reagents
CRO Services
Product recommended

All FLAP Reagents
FLAP cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Mouse arachidonate 5-lipoxygenase activating protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLAP cDNA ORF Clone, Mouse, untagged Alternative Names
Flap cDNA ORF Clone, Mouse
FLAP Background Information

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

Full Name
arachidonate 5-lipoxygenase-activating protein
References
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • FLAP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FLAP cDNA ORF Clone in Cloning Vector, Mouse MG52815-G
    FLAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52815-ACG
    FLAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52815-ACGLN
    FLAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52815-ANG
    FLAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52815-ACR
    FLAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52815-ANR
    FLAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52815-CF
    FLAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52815-NF
    FLAP cDNA ORF Clone, Mouse, C-His tag MG52815-CH
    FLAP cDNA ORF Clone, Mouse, N-His tag MG52815-NH
    FLAP cDNA ORF Clone, Mouse, C-HA tag MG52815-CY
    FLAP cDNA ORF Clone, Mouse, N-HA tag MG52815-NY
    FLAP cDNA ORF Clone, Mouse, C-Myc tag MG52815-CM
    FLAP cDNA ORF Clone, Mouse, N-Myc tag MG52815-NM

    FLAP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FLAP cDNA ORF Clone in Cloning Vector, Human HG11623-M
    FLAP cDNA ORF Clone, Human, untagged HG11623-UT
    FLAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11623-ACGLN
    FLAP cDNA ORF Clone, Human, C-GFPSpark® tag HG11623-ACG
    FLAP cDNA ORF Clone, Human, N-GFPSpark® tag HG11623-ANG
    FLAP cDNA ORF Clone, Human, C-OFPSpark® tag HG11623-ACR
    FLAP cDNA ORF Clone, Human, N-OFPSpark® tag HG11623-ANR
    FLAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11623-CF
    FLAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11623-NF
    FLAP cDNA ORF Clone, Human, C-His tag HG11623-CH
    FLAP cDNA ORF Clone, Human, N-His tag HG11623-NH
    FLAP cDNA ORF Clone, Human, C-HA tag HG11623-CY
    FLAP cDNA ORF Clone, Human, N-HA tag HG11623-NY
    FLAP cDNA ORF Clone, Human, C-Myc tag HG11623-CM
    FLAP cDNA ORF Clone, Human, N-Myc tag HG11623-NM
    FLAP qPCR Primer Pairs, Human HP101437
    info info
    添加购物车成功! 添加购物车失败!