Quick Order

Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse ALOX5AP cDNA Clone Product Information
    NCBI RefSeq:NM_009663.1
    RefSeq ORF Size:486bp
    cDNA Description:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with N terminal His tag.
    Gene Synonym:Flap
    Species:Mouse
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52815-ACG$225
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52815-ACR$225
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52815-ANG$225
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52815-ANR$225
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Flag tagMG52815-CF$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-His tagMG52815-CH$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Myc tagMG52815-CM$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-HA tagMG52815-CY$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone in cloning vectorMG52815-G$75
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-Flag tagMG52815-NF$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tagMG52815-NH$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-Myc tagMG52815-NM$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-HA tagMG52815-NY$195
    Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmidMG52815-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

    References
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Catalog: MG52815-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"