Quick Order

Text Size:AAA

Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse ALOX5AP cDNA Clone Product Information
NCBI RefSeq:NM_009663.1
RefSeq ORF Size:486bp
cDNA Description:Full length Clone DNA of Mus musculus arachidonate 5-lipoxygenase activating protein with C terminal Flag tag.
Gene Synonym:Flap
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52815-ACG$225
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52815-ACR$225
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52815-ANG$225
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52815-ANR$225
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Flag tagMG52815-CF$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-His tagMG52815-CH$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-Myc tagMG52815-CM$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, C-HA tagMG52815-CY$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone in cloning vectorMG52815-G$75
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-Flag tagMG52815-NF$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-His tagMG52815-NH$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-Myc tagMG52815-NM$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmid, N-HA tagMG52815-NY$195
Mouse ALOX5AP / 5-lipoxygenase-activating protein Gene ORF cDNA clone expression plasmidMG52815-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Arachidonate 5-Lipoxygenase-Activating Protein (ALOX5AP), also known as FLAP, belongs to the MAPEG family. ALOX5AP/FLAP is an essential partner of 5-LO for this process. The FLAP (ALOX5AP) gene has been linked to risk for myocardial infarction, stroke and restenosis, reigniting pharmaceutical interest in this target. It had been found that ALOX5AP/FLAP is a key enzyme in leukotriene formation, in both human pulmonary microvascular endothelial cells and a transformed human brain endothelial cell line. In addition, the protein FLAP has recently been identified as an emerging target in metabolic disease. In fact, FLAP is overexpressed in the adipose tissue of patients and experimental animals with obesity.

References
  • Gonsalves CS, et al. (2010) Hypoxia-mediated expression of 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Immunol. 184(7): 3878-88.
  • Zintzaras E, et al. (2009) Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol. 169(5): 523-32.
  • Evans JF, et al. (2008) What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci. 29(2): 72-8.
  • Bck M, et al. (2007) 5-Lipoxygenase-activating protein: a potential link between innate and adaptive immunity in atherosclerosis and adipose tissue inflammation. Circ Res. 100: 946-9.
  • Size / Price
    Catalog: MG52815-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"