BMPRIB cDNA ORF Clone, Mouse, C-His tag

Cat: MG50004-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMPRIB Reagents
CRO Services
Product recommended

All BMPRIB Reagents
BMPRIB cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1509 bp
Description
Full length Clone DNA of Mouse bone morphogenetic protein receptor, type 1B with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMPRIB cDNA ORF Clone, Mouse, C-His tag Alternative Names
Acvrlk6 cDNA ORF Clone, Mouse;AI385617 cDNA ORF Clone, Mouse;ALK-6 cDNA ORF Clone, Mouse;Alk6 cDNA ORF Clone, Mouse;AV355320 cDNA ORF Clone, Mouse;BMPR-1B cDNA ORF Clone, Mouse;BMPR-IB cDNA ORF Clone, Mouse;CFK-43a cDNA ORF Clone, Mouse;SKR6 cDNA ORF Clone, Mouse
BMPRIB Background Information

BMPR1B(bone morphogenetic protein receptor, type IB), also known as ALK6, is a a member of the bone morphogenetic protein (BMP) receptor family. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. BMPR1B is the major transducer of signals in precartilaginous condensations as demonstrated in experiments using constitutively active BMPR1B receptors. BMPR1B is a more effective trasducer of GDF5 than BMPR1A. Unlike BMPR1A null mice, which die at an early embryonic stage, BMPR1B null mice are viable.

Full Name
bone morphogenetic protein receptor, type IB
References
  • Ide H, et al. (1998) Assignment of the BMPR1A and BMPR1B genes to human chromosome 10q22.3 and 4q23--q24 byin situ hybridization and radiation hybrid map ping. Cytogenet. Cell Genet. 81(3-4): 285-6.
  • Mishina Y, et al. (2004) Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem. 279(26): 27560-6.
  • Yoon BS, et al. (2005) Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci. 102(14): 5062-7.
  • BMPRIB cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BMPRIB cDNA ORF Clone in Cloning Vector, Rat RG80128-G
    BMPRIB cDNA ORF Clone, Rat, untagged RG80128-UT
    BMPRIB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80128-ACGLN
    BMPRIB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80128-ACG
    BMPRIB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80128-ACR
    BMPRIB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80128-CF
    BMPRIB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80128-NF
    BMPRIB cDNA ORF Clone, Rat, C-His tag RG80128-CH
    BMPRIB cDNA ORF Clone, Rat, N-His tag RG80128-NH
    BMPRIB cDNA ORF Clone, Rat, C-HA tag RG80128-CY
    BMPRIB cDNA ORF Clone, Rat, N-HA tag RG80128-NY
    BMPRIB cDNA ORF Clone, Rat, C-Myc tag RG80128-CM
    BMPRIB cDNA ORF Clone, Rat, N-Myc tag RG80128-NM
    BMPRIB qPCR Primer Pairs, Rat RP300125

    BMPRIB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMPRIB cDNA ORF Clone in Cloning Vector, Mouse MG50004-M
    BMPRIB cDNA ORF Clone, Mouse, untagged MG50004-UT
    BMPRIB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50004-ACG
    BMPRIB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50004-ACGLN
    BMPRIB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50004-ACR
    BMPRIB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50004-CF
    BMPRIB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50004-NF
    BMPRIB cDNA ORF Clone, Mouse, N-His tag MG50004-NH
    BMPRIB cDNA ORF Clone, Mouse, C-HA tag MG50004-CY
    BMPRIB cDNA ORF Clone, Mouse, N-HA tag MG50004-NY
    BMPRIB cDNA ORF Clone, Mouse, C-Myc tag MG50004-CM
    BMPRIB cDNA ORF Clone, Mouse, N-Myc tag MG50004-NM
    BMPRIB qPCR Primer Pairs, Mouse MP200004

    BMPRIB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMPRIB cDNA ORF Clone in Cloning Vector, Human HG10460-M
    BMPRIB cDNA ORF Clone, Human, untagged HG10460-UT
    BMPRIB cDNA ORF Clone, Human, C-GFPSpark® tag HG10460-ACG
    BMPRIB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10460-ACGLN
    BMPRIB cDNA ORF Clone, Human, C-OFPSpark® tag HG10460-ACR
    BMPRIB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10460-CF
    BMPRIB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10460-NF
    BMPRIB cDNA ORF Clone, Human, C-His tag HG10460-CH
    BMPRIB cDNA ORF Clone, Human, N-His tag HG10460-NH
    BMPRIB cDNA ORF Clone, Human, C-HA tag HG10460-CY
    BMPRIB cDNA ORF Clone, Human, N-HA tag HG10460-NY
    BMPRIB cDNA ORF Clone, Human, C-Myc tag HG10460-CM
    BMPRIB cDNA ORF Clone, Human, N-Myc tag HG10460-NM
    BMPRIB qPCR Primer Pairs, Human HP100488
    info info
    添加购物车成功! 添加购物车失败!