ALDH4A1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51319-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALDH4A1 Reagents
CRO Services
Product recommended

All ALDH4A1 Reagents
ALDH4A1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1689 bp
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase 4 family, member A1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH4A1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
A930035F14Rik cDNA ORF Clone, Mouse;Ahd-1 cDNA ORF Clone, Mouse;Ahd1 cDNA ORF Clone, Mouse;Aldh4 cDNA ORF Clone, Mouse;Aldh5a1 cDNA ORF Clone, Mouse;E330022C09 cDNA ORF Clone, Mouse;P5cd cDNA ORF Clone, Mouse;P5cdh cDNA ORF Clone, Mouse;P5cdhl cDNA ORF Clone, Mouse;P5cdhs cDNA ORF Clone, Mouse;Ssdh1 cDNA ORF Clone, Mouse
ALDH4A1 Background Information

ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism of many molecules including certain fats (cholesterol and other fatty acids) and protein building blocks (amino acids). Additional aldehyde dehydrogenase enzymes detoxify external substances, such as alcohol and pollutants, and internal substances, such as toxins that are formed within cells. ALDH4A1 is expressed abundantly in liver followed by skeletal muscle, kidney, heart, brain, placenta, lung and pancreas. It is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Defects in ALDH4A1 are the cause of hyperprolinemia type 2 (HP-2). HP-2 is characterized by the accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. The disorder may be causally related to neurologic manifestations, including seizures and mental retardation.

Full Name
aldehyde dehydrogenase 4 family, member A1
References
  • Goodman SI, et al. (1974) Defective hydroxyproline metabolism in type II hyperprolinemia. Biochemical medicine. 10 (4): 329-36.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138 (1-2): 171-4.
  • Vasiliou V, et al. (2005) Analysis and update of the human aldehyde dehydrogenase (ALDH) gene family. Hum Genomics. 2 (2): 138-43.
  • ALDH4A1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ALDH4A1 cDNA ORF Clone in Cloning Vector, Rat RG81372-G

    ALDH4A1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ALDH4A1 cDNA ORF Clone in Cloning Vector, Mouse MG51319-G
    ALDH4A1 cDNA ORF Clone, Mouse, untagged MG51319-UT
    ALDH4A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51319-ACG
    ALDH4A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51319-ACGLN
    ALDH4A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51319-ANG
    ALDH4A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51319-ACR
    ALDH4A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51319-ANR
    ALDH4A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51319-CF
    ALDH4A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51319-NF
    ALDH4A1 cDNA ORF Clone, Mouse, C-His tag MG51319-CH
    ALDH4A1 cDNA ORF Clone, Mouse, N-His tag MG51319-NH
    ALDH4A1 cDNA ORF Clone, Mouse, N-HA tag MG51319-NY
    ALDH4A1 cDNA ORF Clone, Mouse, C-Myc tag MG51319-CM
    ALDH4A1 cDNA ORF Clone, Mouse, N-Myc tag MG51319-NM
    ALDH4A1 qPCR Primer Pairs, Mouse MP201196

    ALDH4A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ALDH4A1 cDNA ORF Clone in Cloning Vector, Human HG12856-U
    ALDH4A1 cDNA ORF Clone, Human, untagged HG12856-UT
    ALDH4A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12856-ACGLN
    ALDH4A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12856-ACG
    ALDH4A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12856-ANG
    ALDH4A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12856-ACR
    ALDH4A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12856-ANR
    ALDH4A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12856-CF
    ALDH4A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12856-NF
    ALDH4A1 cDNA ORF Clone, Human, C-His tag HG12856-CH
    ALDH4A1 cDNA ORF Clone, Human, N-His tag HG12856-NH
    ALDH4A1 cDNA ORF Clone, Human, C-HA tag HG12856-CY
    ALDH4A1 cDNA ORF Clone, Human, N-HA tag HG12856-NY
    ALDH4A1 cDNA ORF Clone, Human, C-Myc tag HG12856-CM
    ALDH4A1 cDNA ORF Clone, Human, N-Myc tag HG12856-NM
    info info
    添加购物车成功! 添加购物车失败!