Quick Order

Text Size:AAA

Mouse ALDH4A1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse ALDH4A1 cDNA Clone Product Information
NCBI RefSeq:NM_175438.4
RefSeq ORF Size:1689bp
cDNA Description:Full length Clone DNA of Mus musculus aldehyde dehydrogenase 4 family, member A1 with C terminal HA tag.
Gene Synonym:Ahd1, P5cd, Ahd-1, Aldh4, P5cdh, Ssdh1, P5cdhl, P5cdhs, Aldh5a1, E330022C09, A930035F14Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism of many molecules including certain fats (cholesterol and other fatty acids) and protein building blocks (amino acids). Additional aldehyde dehydrogenase enzymes detoxify external substances, such as alcohol and pollutants, and internal substances, such as toxins that are formed within cells. ALDH4A1 is expressed abundantly in liver followed by skeletal muscle, kidney, heart, brain, placenta, lung and pancreas. It is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Defects in ALDH4A1 are the cause of hyperprolinemia type 2 (HP-2). HP-2 is characterized by the accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. The disorder may be causally related to neurologic manifestations, including seizures and mental retardation.

References
  • Goodman SI, et al. (1974) Defective hydroxyproline metabolism in type II hyperprolinemia. Biochemical medicine. 10 (4): 329-36.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138 (1-2): 171-4.
  • Vasiliou V, et al. (2005) Analysis and update of the human aldehyde dehydrogenase (ALDH) gene family. Hum Genomics. 2 (2): 138-43.
  • Size / Price
    Catalog: MG51319-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"