ALDH1A1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52886-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALDH1A1 Reagents
CRO Services
Product recommended

All ALDH1A1 Reagents
ALDH1A1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase family 1, subfamily A1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH1A1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Ahd-2 cDNA ORF Clone, Mouse;Ahd2 cDNA ORF Clone, Mouse;Aldh1 cDNA ORF Clone, Mouse;Aldh1a2 cDNA ORF Clone, Mouse;E1 cDNA ORF Clone, Mouse;Raldh1 cDNA ORF Clone, Mouse
ALDH1A1 Background Information

Aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), also known as Aldehyde dehydrogenase 1 (ALDH1), or Retinaldehyde Dehydrogenase 1 (RALDH1), is an enzyme that is expressed at high levels in stem cells and that has been suggested to regulate stem cell function. The retinaldehyde dehydrogenase (RALDH) subfamily of ALDHs, composed of ALDH1A1, ALDH1A2, ALDH1A3, and ALDH8A1, regulate development by catalyzing retinoic acid biosynthesis. The ALDH1A1 protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH1A1 also belongs to the group of corneal crystallins that help maintain the transparency of the cornea. Increased ALDH1A1 activity has been found in the stem cell populations of leukemia and some solid tumors. In tumor specimens, increased ALDH1A1 immunopositivity was found not only in secretory type cancer epithelial cells but also in neuroendocrine tumor populations. ALDH1 has been identified as a reliable marker of breast cancer stem cells. ALDH1 expression in primary cancer is an independent prognostic factor in node-positive breast cancer patients. ALDH1A1 plays a key role in normal hematopoiesis, and as a TLX1 transcriptional target, ALDH1A1 may contribute to the ability of this homeoprotein to alter cell fate and induce tumor growth.

Full Name
aldehyde dehydrogenase 1 family, member A1
References
  • Li T, et al. (2010). ALDH1A1 is a marker for malignant prostate stem cells and predictor of prostate cancer patients' outcome. Lab Invest. 90(2): 234-44.
  • Levi BP, et al. (2009) Aldehyde dehydrogenase 1a1 is dispensable for stem cell function in the mouse hematopoietic and nervous systems. Blood. 113(8): 1670-80.
  • Rahman FB, et al. (2006) Uncompetitive inhibition of Xenopus laevis aldehyde dehydrogenase 1A1 by divalent cations. Zoolog Sci. 23(3): 239-44.
  • Jester JV, et al. (1999). The cellular basis of corneal transparency: evidence for corneal crystallins. J Cell Sci. 112 ( Pt 5): 613-22.
  • ALDH1A1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ALDH1A1 cDNA ORF Clone in Cloning Vector, Mouse MG52886-U
    ALDH1A1 cDNA ORF Clone, Mouse, untagged MG52886-UT
    ALDH1A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52886-ACG
    ALDH1A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52886-ACGLN
    ALDH1A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52886-ANG
    ALDH1A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52886-ACR
    ALDH1A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52886-ANR
    ALDH1A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52886-CF
    ALDH1A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52886-NF
    ALDH1A1 cDNA ORF Clone, Mouse, C-His tag MG52886-CH
    ALDH1A1 cDNA ORF Clone, Mouse, N-His tag MG52886-NH
    ALDH1A1 cDNA ORF Clone, Mouse, C-HA tag MG52886-CY
    ALDH1A1 cDNA ORF Clone, Mouse, C-Myc tag MG52886-CM
    ALDH1A1 cDNA ORF Clone, Mouse, N-Myc tag MG52886-NM

    ALDH1A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ALDH1A1 cDNA ORF Clone in Cloning Vector, Human HG11388-M
    ALDH1A1 cDNA ORF Clone, Human, untagged HG11388-UT
    ALDH1A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11388-ACGLN
    ALDH1A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11388-ACG
    ALDH1A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11388-ANG
    ALDH1A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11388-ACR
    ALDH1A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11388-ANR
    ALDH1A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11388-CF
    ALDH1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11388-NF
    ALDH1A1 cDNA ORF Clone, Human, C-His tag HG11388-CH
    ALDH1A1 cDNA ORF Clone, Human, N-His tag HG11388-NH
    ALDH1A1 cDNA ORF Clone, Human, C-HA tag HG11388-CY
    ALDH1A1 cDNA ORF Clone, Human, N-HA tag HG11388-NY
    ALDH1A1 cDNA ORF Clone, Human, C-Myc tag HG11388-CM
    ALDH1A1 cDNA ORF Clone, Human, N-Myc tag HG11388-NM
    ALDH1A1 qPCR Primer Pairs, Human HP100088
    info info
    添加购物车成功! 添加购物车失败!