P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52070-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All P5CS/ALDH18A1 Reagents
CRO Services
Product recommended

All P5CS/ALDH18A1 Reagents
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2388 bp
Description
Full length Clone DNA of Mouse aldehyde dehydrogenase 18 family, member A1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2810433K04Rik cDNA ORF Clone, Mouse;AI429789 cDNA ORF Clone, Mouse;Pycs cDNA ORF Clone, Mouse
P5CS/ALDH18A1 Background Information
Full Name
aldehyde dehydrogenase 18 family, member A1

P5CS/ALDH18A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
P5CS/ALDH18A1 cDNA ORF Clone in Cloning Vector, Mouse MG52070-G
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, untagged MG52070-UT
P5CS/ALDH18A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52070-ACGLN
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52070-ACG
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52070-ANG
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52070-ACR
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52070-ANR
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52070-CF
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52070-NF
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, C-His tag MG52070-CH
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-His tag MG52070-NH
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, C-HA tag MG52070-CY
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, C-Myc tag MG52070-CM
P5CS/ALDH18A1 cDNA ORF Clone, Mouse, N-Myc tag MG52070-NM
P5CS/ALDH18A1 qPCR Primer Pairs, Mouse MP201943

P5CS/ALDH18A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
P5CS/ALDH18A1 cDNA ORF Clone in Cloning Vector, Human HG20183-U
P5CS/ALDH18A1 cDNA ORF Clone, Human, untagged HG20183-UT
P5CS/ALDH18A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20183-ACGLN
P5CS/ALDH18A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG20183-ACG
P5CS/ALDH18A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG20183-ANG
P5CS/ALDH18A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG20183-ACR
P5CS/ALDH18A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG20183-ANR
P5CS/ALDH18A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20183-CF
P5CS/ALDH18A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20183-NF
P5CS/ALDH18A1 cDNA ORF Clone, Human, C-His tag HG20183-CH
P5CS/ALDH18A1 cDNA ORF Clone, Human, N-His tag HG20183-NH
P5CS/ALDH18A1 cDNA ORF Clone, Human, C-HA tag HG20183-CY
P5CS/ALDH18A1 cDNA ORF Clone, Human, N-HA tag HG20183-NY
P5CS/ALDH18A1 cDNA ORF Clone, Human, C-Myc tag HG20183-CM
P5CS/ALDH18A1 cDNA ORF Clone, Human, N-Myc tag HG20183-NM
info info
添加购物车成功! 添加购物车失败!