Serum Albumin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52912-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Serum Albumin Reagents
CRO Services
Product recommended

All Serum Albumin Reagents
Serum Albumin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1827 bp
Description
Full length Clone DNA of Mouse albumin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Serum Albumin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Alb-1 cDNA ORF Clone, Mouse;Alb1 cDNA ORF Clone, Mouse
Serum Albumin Background Information
Full Name
albumin

Serum Albumin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Serum Albumin cDNA ORF Clone in Cloning Vector, Rat RG80495-U
Serum Albumin cDNA ORF Clone, Rat, untagged RG80495-UT
Serum Albumin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80495-ACGLN
Serum Albumin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80495-ACG
Serum Albumin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80495-ACR
Serum Albumin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80495-CF
Serum Albumin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80495-NF
Serum Albumin cDNA ORF Clone, Rat, C-His tag RG80495-CH
Serum Albumin cDNA ORF Clone, Rat, N-His tag RG80495-NH
Serum Albumin cDNA ORF Clone, Rat, C-HA tag RG80495-CY
Serum Albumin cDNA ORF Clone, Rat, N-HA tag RG80495-NY
Serum Albumin cDNA ORF Clone, Rat, C-Myc tag RG80495-CM
Serum Albumin cDNA ORF Clone, Rat, N-Myc tag RG80495-NM
Serum Albumin qPCR Primer Pairs, Rat RP300459

Serum Albumin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Serum Albumin cDNA ORF Clone in Cloning Vector, Mouse MG52912-G
Serum Albumin cDNA ORF Clone, Mouse, untagged MG52912-UT
Serum Albumin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52912-ACG
Serum Albumin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52912-ACGLN
Serum Albumin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52912-ACR
Serum Albumin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52912-NF
Serum Albumin cDNA ORF Clone, Mouse, C-His tag MG52912-CH
Serum Albumin cDNA ORF Clone, Mouse, N-His tag MG52912-NH
Serum Albumin cDNA ORF Clone, Mouse, C-HA tag MG52912-CY
Serum Albumin cDNA ORF Clone, Mouse, N-HA tag MG52912-NY
Serum Albumin cDNA ORF Clone, Mouse, C-Myc tag MG52912-CM
Serum Albumin cDNA ORF Clone, Mouse, N-Myc tag MG52912-NM

Serum Albumin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Serum Albumin cDNA ORF Clone in Cloning Vector, Human HG10968-G
Serum Albumin cDNA ORF Clone, Human, untagged HG10968-UT
Serum Albumin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10968-ACGLN
Serum Albumin cDNA ORF Clone, Human, C-GFPSpark® tag HG10968-ACG
Serum Albumin cDNA ORF Clone, Human, C-OFPSpark® tag HG10968-ACR
Serum Albumin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10968-CF
Serum Albumin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10968-NF
Serum Albumin cDNA ORF Clone, Human, C-His tag HG10968-CH
Serum Albumin cDNA ORF Clone, Human, N-His tag HG10968-NH
Serum Albumin cDNA ORF Clone, Human, C-HA tag HG10968-CY
Serum Albumin cDNA ORF Clone, Human, N-HA tag HG10968-NY
Serum Albumin cDNA ORF Clone, Human, C-Myc tag HG10968-CM
Serum Albumin cDNA ORF Clone, Human, N-Myc tag HG10968-NM
Serum Albumin qPCR Primer Pairs, Human HP100843
info info
添加购物车成功! 添加购物车失败!