FTS cDNA ORF Clone, Mouse, untagged

Cat: MG51560-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FTS Reagents
CRO Services
Product recommended

All FTS Reagents
FTS cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Mouse thymoma viral proto-oncogene 1 interacting protein
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTS cDNA ORF Clone, Mouse, untagged Alternative Names
AL023020 cDNA ORF Clone, Mouse;Fif cDNA ORF Clone, Mouse;Ft cDNA ORF Clone, Mouse;Ft1 cDNA ORF Clone, Mouse;Fts cDNA ORF Clone, Mouse
FTS Background Information
Full Name
AKT interacting protein

FTS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FTS cDNA ORF Clone in Cloning Vector, Mouse MG51560-U
FTS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51560-ACG
FTS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51560-ACGLN
FTS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51560-ANG
FTS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51560-ACR
FTS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51560-ANR
FTS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51560-CF
FTS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51560-NF
FTS cDNA ORF Clone, Mouse, C-His tag MG51560-CH
FTS cDNA ORF Clone, Mouse, N-His tag MG51560-NH
FTS cDNA ORF Clone, Mouse, C-HA tag MG51560-CY
FTS cDNA ORF Clone, Mouse, N-HA tag MG51560-NY
FTS cDNA ORF Clone, Mouse, C-Myc tag MG51560-CM
FTS cDNA ORF Clone, Mouse, N-Myc tag MG51560-NM
FTS qPCR Primer Pairs, Mouse MP201443

FTS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FTS cDNA ORF Clone in Cloning Vector, Human HG15065-G
FTS cDNA ORF Clone, Human, untagged HG15065-UT
FTS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15065-ACGLN
FTS cDNA ORF Clone, Human, C-GFPSpark® tag HG15065-ACG
FTS cDNA ORF Clone, Human, N-GFPSpark® tag HG15065-ANG
FTS cDNA ORF Clone, Human, C-OFPSpark® tag HG15065-ACR
FTS cDNA ORF Clone, Human, N-OFPSpark® tag HG15065-ANR
FTS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15065-CF
FTS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15065-NF
FTS cDNA ORF Clone, Human, C-His tag HG15065-CH
FTS cDNA ORF Clone, Human, N-His tag HG15065-NH
FTS cDNA ORF Clone, Human, C-HA tag HG15065-CY
FTS cDNA ORF Clone, Human, N-HA tag HG15065-NY
FTS cDNA ORF Clone, Human, C-Myc tag HG15065-CM
FTS cDNA ORF Clone, Human, N-Myc tag HG15065-NM
FTS qPCR Primer Pairs, Human HP103693
info info
添加购物车成功! 添加购物车失败!