Quick Order

Mouse AKR1A1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse AKR1A1 cDNA Clone Product Information
NCBI RefSeq:NM_021473.3
RefSeq ORF Size:978bp
cDNA Description:Full length Clone DNA of Mus musculus aldo-keto reductase family 1, member A1 (aldehyde reductase) with N terminal HA tag.
Gene Synonym:Akr1a4, 2610201A18Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Aldehyde reductase (AKR1A1) is a member of the aldo-keto reductase superfamily, which consists of more than 40 known enzymes and proteins that includes variety of monomeric NADPH-dependent oxidoreductases, such as aldehyde reductase. Aldehyde reductase has wide substrate specificities for carbonyl compounds. These enzymes are implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Aldehyde reductase possess a structure with a beta-alpha-beta fold which contains a novel NADP-binding motif. The binding site is located in a large, deep, elliptical pocket in the C-terminal end of the beta sheet, the substrate being bound in an extended conformation. This binding is more similar to FAD- than to NAD(P)-binding oxidoreductases. AKR1A1 is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue.

References
  • Bohren KM, et al. (1989) The aldo-keto reductase superfamily. cDNAs and deduced amino acid sequences of human aldehyde and aldose reductases. J Biol Chem. 264 (16): 9547-51.
  • Fujii J, et al. (1999) The structural organization of the human aldehyde reductase gene, AKR1A1, and mapping to chromosome. Cytogenetics and Cell Genetics . 84 (3-4): 33-2.
  • Size / Price
    Catalog: MG52953-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"