AKIRIN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52328-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AKIRIN1 Reagents
CRO Services
Product recommended

All AKIRIN1 Reagents
AKIRIN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Mouse akirin 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AKIRIN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
6330407G11Rik cDNA ORF Clone, Mouse
AKIRIN1 Background Information
Full Name
akirin 1

AKIRIN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AKIRIN1 cDNA ORF Clone in Cloning Vector, Mouse MG52328-U
AKIRIN1 cDNA ORF Clone, Mouse, untagged MG52328-UT
AKIRIN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52328-ACGLN
AKIRIN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52328-ACG
AKIRIN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52328-ANG
AKIRIN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52328-ACR
AKIRIN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52328-ANR
AKIRIN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52328-NF
AKIRIN1 cDNA ORF Clone, Mouse, C-His tag MG52328-CH
AKIRIN1 cDNA ORF Clone, Mouse, N-His tag MG52328-NH
AKIRIN1 cDNA ORF Clone, Mouse, C-HA tag MG52328-CY
AKIRIN1 cDNA ORF Clone, Mouse, N-HA tag MG52328-NY
AKIRIN1 cDNA ORF Clone, Mouse, C-Myc tag MG52328-CM
AKIRIN1 cDNA ORF Clone, Mouse, N-Myc tag MG52328-NM
AKIRIN1 qPCR Primer Pairs, Mouse MP202201

AKIRIN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AKIRIN1 cDNA ORF Clone in Cloning Vector, Human HG25604-U
AKIRIN1 cDNA ORF Clone, Human, untagged HG25604-UT
AKIRIN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG25604-ACG
AKIRIN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25604-ACGLN
AKIRIN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG25604-ANG
AKIRIN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG25604-ACR
AKIRIN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG25604-ANR
AKIRIN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25604-CF
AKIRIN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25604-NF
AKIRIN1 cDNA ORF Clone, Human, C-His tag HG25604-CH
AKIRIN1 cDNA ORF Clone, Human, N-His tag HG25604-NH
AKIRIN1 cDNA ORF Clone, Human, C-HA tag HG25604-CY
AKIRIN1 cDNA ORF Clone, Human, N-HA tag HG25604-NY
AKIRIN1 cDNA ORF Clone, Human, C-Myc tag HG25604-CM
AKIRIN1 cDNA ORF Clone, Human, N-Myc tag HG25604-NM
info info
添加购物车成功! 添加购物车失败!