AJAP1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52275-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AJAP1 Reagents
CRO Services
Product recommended

All AJAP1 Reagents
AJAP1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Mouse adherens junction associated protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AJAP1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Gm573 cDNA ORF Clone, Mouse
AJAP1 Background Information
Full Name
adherens junctions associated protein 1

AJAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AJAP1 cDNA ORF Clone in Cloning Vector, Mouse MG52275-G
AJAP1 cDNA ORF Clone, Mouse, untagged MG52275-UT
AJAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52275-ACGLN
AJAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52275-ACG
AJAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52275-ACR
AJAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52275-CF
AJAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52275-NF
AJAP1 cDNA ORF Clone, Mouse, C-His tag MG52275-CH
AJAP1 cDNA ORF Clone, Mouse, N-His tag MG52275-NH
AJAP1 cDNA ORF Clone, Mouse, C-HA tag MG52275-CY
AJAP1 cDNA ORF Clone, Mouse, C-Myc tag MG52275-CM
AJAP1 cDNA ORF Clone, Mouse, N-Myc tag MG52275-NM
AJAP1 qPCR Primer Pairs, Mouse MP202148

AJAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AJAP1 cDNA ORF Clone in Cloning Vector, Human HG13392-G
AJAP1 cDNA ORF Clone, Human, untagged HG13392-UT
AJAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13392-ACG
AJAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13392-ACGLN
AJAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13392-ACR
AJAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13392-CF
AJAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13392-NF
AJAP1 cDNA ORF Clone, Human, C-His tag HG13392-CH
AJAP1 cDNA ORF Clone, Human, N-His tag HG13392-NH
AJAP1 cDNA ORF Clone, Human, C-HA tag HG13392-CY
AJAP1 cDNA ORF Clone, Human, N-HA tag HG13392-NY
AJAP1 cDNA ORF Clone, Human, C-Myc tag HG13392-CM
AJAP1 cDNA ORF Clone, Human, N-Myc tag HG13392-NM
AJAP1 qPCR Primer Pairs, Human HP102096
info info
添加购物车成功! 添加购物车失败!