AIFM2/AMID cDNA ORF Clone, Mouse, N-His tag

Cat: MG52065-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AIFM2/AMID Reagents
CRO Services
Product recommended

All AIFM2/AMID Reagents
AIFM2/AMID cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1122 bp
Description
Full length Clone DNA of Mouse apoptosis-inducing factor, mitochondrion-associated 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AIFM2/AMID cDNA ORF Clone, Mouse, N-His tag Alternative Names
5430437E11Rik cDNA ORF Clone, Mouse;Amid cDNA ORF Clone, Mouse;D730001I10Rik cDNA ORF Clone, Mouse;PRG3 cDNA ORF Clone, Mouse
AIFM2/AMID Background Information
Full Name
apoptosis-inducing factor, mitochondrion-associated, 2

AIFM2/AMID cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AIFM2/AMID cDNA ORF Clone in Cloning Vector, Rat RG80918-U
AIFM2/AMID cDNA ORF Clone, Rat, untagged RG80918-UT
AIFM2/AMID Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80918-ACGLN
AIFM2/AMID cDNA ORF Clone, Rat, C-GFPSpark® tag RG80918-ACG
AIFM2/AMID cDNA ORF Clone, Rat, C-OFPSpark® tag RG80918-ACR
AIFM2/AMID cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80918-CF
AIFM2/AMID cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80918-NF
AIFM2/AMID cDNA ORF Clone, Rat, C-His tag RG80918-CH
AIFM2/AMID cDNA ORF Clone, Rat, N-His tag RG80918-NH
AIFM2/AMID cDNA ORF Clone, Rat, C-HA tag RG80918-CY
AIFM2/AMID cDNA ORF Clone, Rat, N-HA tag RG80918-NY
AIFM2/AMID cDNA ORF Clone, Rat, C-Myc tag RG80918-CM
AIFM2/AMID cDNA ORF Clone, Rat, N-Myc tag RG80918-NM
AIFM2/AMID qPCR Primer Pairs, Rat RP300882

AIFM2/AMID cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AIFM2/AMID cDNA ORF Clone in Cloning Vector, Mouse MG52065-U
AIFM2/AMID cDNA ORF Clone, Mouse, untagged MG52065-UT
AIFM2/AMID cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52065-ACG
AIFM2/AMID Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52065-ACGLN
AIFM2/AMID cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52065-ANG
AIFM2/AMID cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52065-ACR
AIFM2/AMID cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52065-ANR
AIFM2/AMID cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52065-CF
AIFM2/AMID cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52065-NF
AIFM2/AMID cDNA ORF Clone, Mouse, C-His tag MG52065-CH
AIFM2/AMID cDNA ORF Clone, Mouse, C-HA tag MG52065-CY
AIFM2/AMID cDNA ORF Clone, Mouse, N-HA tag MG52065-NY
AIFM2/AMID cDNA ORF Clone, Mouse, C-Myc tag MG52065-CM
AIFM2/AMID cDNA ORF Clone, Mouse, N-Myc tag MG52065-NM
AIFM2/AMID qPCR Primer Pairs, Mouse MP201938

AIFM2/AMID cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AIFM2/AMID cDNA ORF Clone, Human, untagged HG21080-UT
info info
添加购物车成功! 添加购物车失败!