Aha1/AHSA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51702-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Aha1/AHSA1 Reagents
CRO Services
Product recommended

All Aha1/AHSA1 Reagents
Aha1/AHSA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1017 bp
Description
Full length Clone DNA of Mouse AHA1, activator of heat shock protein ATPase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aha1/AHSA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
BC023857 cDNA ORF Clone, Mouse;p38 cDNA ORF Clone, Mouse
Aha1/AHSA1 Background Information
Full Name
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast)

Aha1/AHSA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Aha1/AHSA1 cDNA ORF Clone in Cloning Vector, Rat RG81202-U
Aha1/AHSA1 cDNA ORF Clone, Rat, untagged RG81202-UT
Aha1/AHSA1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81202-ACG
Aha1/AHSA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81202-ACGLN
Aha1/AHSA1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81202-ANG
Aha1/AHSA1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81202-ACR
Aha1/AHSA1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81202-ANR
Aha1/AHSA1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81202-CF
Aha1/AHSA1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81202-NF
Aha1/AHSA1 cDNA ORF Clone, Rat, C-His tag RG81202-CH
Aha1/AHSA1 cDNA ORF Clone, Rat, N-His tag RG81202-NH
Aha1/AHSA1 cDNA ORF Clone, Rat, C-HA tag RG81202-CY
Aha1/AHSA1 cDNA ORF Clone, Rat, N-HA tag RG81202-NY
Aha1/AHSA1 cDNA ORF Clone, Rat, C-Myc tag RG81202-CM
Aha1/AHSA1 cDNA ORF Clone, Rat, N-Myc tag RG81202-NM
Aha1/AHSA1 qPCR Primer Pairs, Rat RP301158

Aha1/AHSA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Aha1/AHSA1 cDNA ORF Clone in Cloning Vector, Mouse MG51702-U
Aha1/AHSA1 cDNA ORF Clone, Mouse, untagged MG51702-UT
Aha1/AHSA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51702-ACG
Aha1/AHSA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51702-ACGLN
Aha1/AHSA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51702-ANG
Aha1/AHSA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51702-ACR
Aha1/AHSA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51702-ANR
Aha1/AHSA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51702-NF
Aha1/AHSA1 cDNA ORF Clone, Mouse, C-His tag MG51702-CH
Aha1/AHSA1 cDNA ORF Clone, Mouse, N-His tag MG51702-NH
Aha1/AHSA1 cDNA ORF Clone, Mouse, C-HA tag MG51702-CY
Aha1/AHSA1 cDNA ORF Clone, Mouse, N-HA tag MG51702-NY
Aha1/AHSA1 cDNA ORF Clone, Mouse, C-Myc tag MG51702-CM
Aha1/AHSA1 cDNA ORF Clone, Mouse, N-Myc tag MG51702-NM
Aha1/AHSA1 qPCR Primer Pairs, Mouse MP201575

Aha1/AHSA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Aha1/AHSA1 cDNA ORF Clone in Cloning Vector, Human HG11393-M
Aha1/AHSA1 cDNA ORF Clone, Human, untagged HG11393-UT
Aha1/AHSA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11393-ACG
Aha1/AHSA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11393-ACGLN
Aha1/AHSA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11393-ANG
Aha1/AHSA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11393-ACR
Aha1/AHSA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11393-ANR
Aha1/AHSA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11393-CF
Aha1/AHSA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11393-NF
Aha1/AHSA1 cDNA ORF Clone, Human, C-His tag HG11393-CH
Aha1/AHSA1 cDNA ORF Clone, Human, N-His tag HG11393-NH
Aha1/AHSA1 cDNA ORF Clone, Human, C-HA tag HG11393-CY
Aha1/AHSA1 cDNA ORF Clone, Human, N-HA tag HG11393-NY
Aha1/AHSA1 cDNA ORF Clone, Human, C-Myc tag HG11393-CM
Aha1/AHSA1 cDNA ORF Clone, Human, N-Myc tag HG11393-NM
Aha1/AHSA1 qPCR Primer Pairs, Human HP101270
info info
添加购物车成功! 添加购物车失败!