Quick Order

Mouse Angiotensinogen/SerpinA8 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse AGT cDNA Clone Product Information
NCBI RefSeq:NM_007428.3
RefSeq ORF Size:1449bp
cDNA Description:Full length Clone DNA of Mus musculus angiotensinogen (serpin peptidase inhibitor, clade A, member 8).
Gene Synonym:AngI, AngII, Aogen, AI265500, Serpina8
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with AGT qPCR primers for gene expression analysis, MP200360 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Angiotensinogen, also known as AGT and SerpinA8, is a member of the serpin family. It is an α-2-globulin that is produced constitutively and released into the circulation mainly by the liver. Angiotensinogen is a essential component of the renin-angiotensin system (RAS) and a potent regulator of blood pressure. Angiotensinogen can be schematically considered to consist of a combination of an angiotensin I (Ang I) function, located at the N-terminal end, and the presence of a serpin (serine protease inhibitor) structure at the opposite end. Angiotensinogen is cleaved into three chains: Angiotensin-1 (Ang I), Angiotensin-2 (Ang II), and Angiotensin-3 (Ang III). Angiotensin-1 is a substrate of ACE (angiotensin converting enzyme) that removes a dipeptide to yield the physiologically active peptide angiotensin-2. Angiotensin-1 and angiotensin-2 can be further processed to generate angiotensin-3, angiotensin-4. Angiotensin 1-7 is cleaved from angiotensin-2 by ACE2. Angiotensin-2 acts directly on vascular smooth muscle as a potent vasoconstrictor, affects cardiac contractility and heart rate through its action on the sympathetic nervous system. Defects in AGT are associated with susceptibility to essential hypertension and renal tubular dysgenesis (RTD). Several serpins (antithrombin, maspin, pigment epithelial-derived factor, and kallistatin) have been recently shown to exert an antiangiogenic activity, suggesting a common mechanism of endothelial cell proliferation and migration. Angiotensinogen/AGT and its renin-cleaved product, des(Ang I)AGT, are also angiogenesis inhibitors, both in vitro and in vivo at concentrations within the range of those observed in plasma. The Angiotensinogen products, that is angiotensin II and possibly angiotensin II-related products, have been found to act locally in modulating adipose tissue growth in an autocrine/paracrine manner. The transient or chronic overexpression of angiotensinogen in adipose tissue favors lipogenesis in adipocytes and leads to a 'vicious' circle whereby adipose tissue development is further increased.

References
  • Ailhaud G, et al. (2002) Angiotensinogen, adipocyte differentiation and fat mass enlargement. Curr Opin Clin Nutr Metab Care. 5(4): 385-9.
  • Corvol P, et al. (2003) Inhibition of angiogenesis: a new function for angiotensinogen and des(angiotensin I)angiotensinogen. Curr Hypertens Rep. 5(2): 149-54.
  • Size / Price
    Catalog: MG50337-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"