Quick Order

Mouse AGRP Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse AGRP cDNA Clone Product Information
    NCBI RefSeq:NM_007427.2
    RefSeq ORF Size:396bp
    cDNA Description:Full length Clone DNA of Mus musculus agouti related protein.
    Gene Synonym:Art, Agrt, Agrp
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AGRP qPCR primers for gene expression analysis, MP200300 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found in the hypothalamus and exhibits potent orexigenic activity. AGRP can act as a competitive antagonist to proopiomelanocortin (POMC)-derived peptides at the melanocortin-4 receptor (MC4R), and that this homeostatic mechanism is important as a means of coordinating appetite with perceived metabolic requirement. AGRP is upregulated by fasting while intracerebroventricular injections of synthetic AGRP lead to increased appetite and food intake. Thus, AGRP is a powerful orexigenic peptide that increases food intake when ubiquitously overexpressed or when administered centrally.

    References
  • Ilnytska O, et al. (2008) The role of the Agouti-Related Protein in energy balance regulation. Cell Mol Life Sci. 65(17): 2721-31.
  • Pritchard LE, et al. (2005) Agouti-related protein: more than a melanocortin-4 receptor antagonist? Peptides. 26(10): 1759-70.
  • Sttz AM, et al. (2005) The agouti-related protein and its role in energy homeostasis. Peptides. 26(10): 1771-81.
  • Millhauser GL, et al. (2003) Loops and links: structural insights into the remarkable function of the agouti-related protein. Ann N Y Acad Sci. 994: 27-35.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"