Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52173-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Amino-terminal enhancer of split Reagents
CRO Services
Product recommended

All Amino-terminal enhancer of split Reagents
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
594 bp
Description
Full length Clone DNA of Mouse amino-terminal enhancer of split with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AL024115 cDNA ORF Clone, Mouse;Esp1 cDNA ORF Clone, Mouse;Grg cDNA ORF Clone, Mouse;Grg-5 cDNA ORF Clone, Mouse;Grg5 cDNA ORF Clone, Mouse;Tle5 cDNA ORF Clone, Mouse
Amino-terminal enhancer of split Background Information
Full Name
amino-terminal enhancer of split

Amino-terminal enhancer of split cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Amino-terminal enhancer of split cDNA ORF Clone in Cloning Vector, Mouse MG52173-G
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, untagged MG52173-UT
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52173-ACG
Amino-terminal enhancer of split Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52173-ACGLN
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52173-ANG
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52173-ACR
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52173-ANR
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52173-CF
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52173-NF
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, C-His tag MG52173-CH
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-His tag MG52173-NH
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, C-HA tag MG52173-CY
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, C-Myc tag MG52173-CM
Amino-terminal enhancer of split cDNA ORF Clone, Mouse, N-Myc tag MG52173-NM
Amino-terminal enhancer of split qPCR Primer Pairs, Mouse MP202046

Amino-terminal enhancer of split cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Amino-terminal enhancer of split cDNA ORF Clone in Cloning Vector, Human HG19552-U
info info
添加购物车成功! 添加购物车失败!