Quick Order

Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse ADPRH cDNA Clone Product Information
NCBI RefSeq:NM_007414.3
RefSeq ORF Size:1089bp
cDNA Description:Full length Clone DNA of Mus musculus ADP-ribosylarginine hydrolase.
Gene Synonym:Arh1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ADPRH qPCR primers for gene expression analysis, MP201467 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid on other vectors
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51584-ACG$225
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51584-ACR$225
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51584-ANG$225
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51584-ANR$225
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, C-Flag tagMG51584-CF$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, C-His tagMG51584-CH$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, C-Myc tagMG51584-CM$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, C-HA tagMG51584-CY$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone in cloning vectorMG51584-G$75
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, N-Flag tagMG51584-NF$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, N-His tagMG51584-NH$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, N-Myc tagMG51584-NM$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmid, N-HA tagMG51584-NY$195
Mouse ADPRH/ADP ribosylarginine hydrolase Gene ORF cDNA clone expression plasmidMG51584-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: MG51584-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"