ADAM9 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50044-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ADAM9 Reagents
CRO Services
Product recommended

All ADAM9 Reagents
ADAM9 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2538 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse a disintegrin and metallopeptidase domain 9 (meltrin gamma) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + NotI (6kb + 2.59kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ADAM9 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ADAM9 cDNA ORF Clone, Mouse, C-HA tag Validated Images
Rhesus TLR4 / TLR-4 Gene Plasmid Map 5626
ADAM9 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AU020942 cDNA ORF Clone, Mouse;MDC9 cDNA ORF Clone, Mouse;mKIAA0021 cDNA ORF Clone, Mouse;Mltng cDNA ORF Clone, Mouse
ADAM9 Background Information

ADAM9 (A disintegrin and metallopeptidase domain 9, MDC9, meltrin gamma), is a type 1 transmembrane protein that has been associated with cancer development and metastases. ADAM9 is consistently overexpressed in various human cancers, and plays a role in tumorigenesis in mouse models. ADAM9 cleaves and releases a number of molecules with important roles in tumorigenesis and angiogenesis, such as EGF, FGFR2iiib, Tie-2, Flk-1, EphB4, CD40, VCAM-1, and VE-cadherin, and could represent a potential therapeutic target in tumors where it is highly expressed. ADAM9 belongs to a family of transmembrane, disintegrin-containing metalloproteinases involved in protein ectodomain shedding and cell-cell and cell-matrix interactions. ADAM-9 adhesive domain plays a role in regulating the motility of cells by interaction with beta1 integrins and modulates MMP synthesis.

Full Name
ADAM metallopeptidase domain 9
References
  • Caltabiano R, et al. (2011) ADAM-9 expression in intestinal-type adenocarcinoma of the sinonasal tract. Appl Immunohistochem Mol Morphol. 19(3): 283-7.
  • Peduto L. (2009) ADAM9 as a potential target molecule in cancer. Curr Pharm Des. 15(20): 2282-7.
  • Zigrino P, et al. (2007) Role of ADAM-9 disintegrin-cysteine-rich domains in human keratinocyte migration. J Biol Chem. 282(42): 30785-93.
  • info info
    添加购物车成功! 添加购物车失败!