Aminoacylase 1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50008-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Aminoacylase 1 Reagents
CRO Services
Product recommended

All Aminoacylase 1 Reagents
Aminoacylase 1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Description
Full length Clone DNA of Mouse aminoacylase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aminoacylase 1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1110014J22Rik cDNA ORF Clone, Mouse;Acy-1 cDNA ORF Clone, Mouse
Aminoacylase 1 Background Information

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

Full Name
aminoacylase 1
References
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Aminoacylase 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Aminoacylase 1 cDNA ORF Clone in Cloning Vector, Mouse MG50008-M
    Aminoacylase 1 cDNA ORF Clone, Mouse, untagged MG50008-UT
    Aminoacylase 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50008-ACG
    Aminoacylase 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50008-ACGLN
    Aminoacylase 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50008-ANG
    Aminoacylase 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50008-ACR
    Aminoacylase 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50008-ANR
    Aminoacylase 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50008-CF
    Aminoacylase 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50008-NF
    Aminoacylase 1 cDNA ORF Clone, Mouse, C-His tag MG50008-CH
    Aminoacylase 1 cDNA ORF Clone, Mouse, N-His tag MG50008-NH
    Aminoacylase 1 cDNA ORF Clone, Mouse, C-HA tag MG50008-CY
    Aminoacylase 1 cDNA ORF Clone, Mouse, C-Myc tag MG50008-CM
    Aminoacylase 1 cDNA ORF Clone, Mouse, N-Myc tag MG50008-NM
    Aminoacylase 1 qPCR Primer Pairs, Mouse MP200008

    Aminoacylase 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Aminoacylase 1 cDNA ORF Clone in Cloning Vector, Human HG10549-M
    Aminoacylase 1 cDNA ORF Clone, Human, untagged HG10549-UT
    Aminoacylase 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10549-ACGLN
    Aminoacylase 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10549-ACG
    Aminoacylase 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10549-ANG
    Aminoacylase 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10549-ACR
    Aminoacylase 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10549-ANR
    Aminoacylase 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10549-CF
    Aminoacylase 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10549-NF
    Aminoacylase 1 cDNA ORF Clone, Human, C-His tag HG10549-CH
    Aminoacylase 1 cDNA ORF Clone, Human, N-His tag HG10549-NH
    Aminoacylase 1 cDNA ORF Clone, Human, C-HA tag HG10549-CY
    Aminoacylase 1 cDNA ORF Clone, Human, N-HA tag HG10549-NY
    Aminoacylase 1 cDNA ORF Clone, Human, C-Myc tag HG10549-CM
    Aminoacylase 1 cDNA ORF Clone, Human, N-Myc tag HG10549-NM
    Aminoacylase 1 qPCR Primer Pairs, Human HP100038
    info info
    添加购物车成功! 添加购物车失败!