Quick Order

Text Size:AAA

Mouse Aminoacylase-1/ACY1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse ACY1 cDNA Clone Product Information
NCBI RefSeq:NM_025371.2
RefSeq ORF Size:1227bp
cDNA Description:Full length Clone DNA of Mus musculus aminoacylase 1 with C terminal His tag.
Gene Synonym:Acy-1, 1110014J22Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

References
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Catalog: MG50008-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"