Quick Order

Mouse ACVR2A ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse ACVR2A cDNA Clone Product Information
NCBI RefSeq:NM_007396.4
RefSeq ORF Size:1542bp
cDNA Description:Full length Clone DNA of Mus musculus activin receptor IIA with C terminal HA tag.
Gene Synonym:Acvr2, ActRIIa, tActRII, Acvr2a
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:pCMV3-mACVR2A-HA
Restriction Site:HindIII + XbaI (6kb + 1.58kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1512T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ACVR2A Gene Plasmid Map
Mouse ACVR2A ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA, SYNJ2BP and ACVR1B. The bovine ACVR2A gene encodes a protein of 513 amino acids which is highly homologous (approximately 98% identity) to the rat, mouse, and human ACVR2A proteins. Inactivation of ACVR2A is a common event in prostate cancer cells suggesting it may play an important role in the development of prostate cancer. The ACVR2A gene is a putative tumor suppressor gene that is frequently mutated in microsatellite-unstable colon cancers (MSI-H colon cancers). Frameshift mutation of ACVR2A may contribute to MSI-H colon tumorigenesis via disruption of alternate TGF-beta effector pathways.

References
  • Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.
  • Chung H, et al. (2008) Mutation rates of TGFBR2 and ACVR2 coding microsatellites in human cells with defective DNA mismatch repair. PloS one 3(10): e3463.
  • Fitzpatrick E, et al. (2009) Genetic association of the activin A receptor gene (ACVR2A) and pre-eclampsia. Molecular human reproduction 15(3):195-204.
  • Roten LT, et al. (2009) Association between the candidate susceptibility gene ACVR2A on chromosome 2q22 and pre-eclampsia in a large Norwegian population-based study (the HUNT study). EJHG. 17(2): 250-7.
  • Size / Price
    Catalog: MG50613-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"