Text Size:AAA

Mouse ABCE1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

DatasheetReviewsRelated ProductsProtocols
Mouse ABCE1 cDNA Clone Product Information
NCBI RefSeq:NM_015751.2
RefSeq ORF Size:1800bp
cDNA Description:Full length Clone DNA of Mus musculus ATP-binding cassette, sub-family E (OABP), member 1 with C terminal GFPSpark tag.
Gene Synonym:RLI, Oabp, RNS41, C79080, Rnaseli
Species:Mouse
Vector:pCMV3-C-GFPSpark
Plasmid:
Restriction Site:
Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
GFPSpark Tag Info

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Product nameProduct name
Size / Price
Catalog: MG53040-ACG
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"