Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52859-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Aminoadipate aminotransferase Reagents
CRO Services
Product recommended

All Aminoadipate aminotransferase Reagents
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Description
Full length Clone DNA of Mouse aminoadipate aminotransferase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Aadt cDNA ORF Clone, Mouse;AI875679 cDNA ORF Clone, Mouse;Kat2 cDNA ORF Clone, Mouse;KATII cDNA ORF Clone, Mouse;mKat-2 cDNA ORF Clone, Mouse
Aminoadipate aminotransferase Background Information
Full Name
aminoadipate aminotransferase

Aminoadipate aminotransferase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Aminoadipate aminotransferase cDNA ORF Clone in Cloning Vector, Rat RG80844-U
Aminoadipate aminotransferase cDNA ORF Clone, Rat, untagged RG80844-UT
Aminoadipate aminotransferase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80844-ACGLN
Aminoadipate aminotransferase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80844-ACG
Aminoadipate aminotransferase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80844-ANG
Aminoadipate aminotransferase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80844-ACR
Aminoadipate aminotransferase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80844-ANR
Aminoadipate aminotransferase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80844-CF
Aminoadipate aminotransferase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80844-NF
Aminoadipate aminotransferase cDNA ORF Clone, Rat, C-His tag RG80844-CH
Aminoadipate aminotransferase cDNA ORF Clone, Rat, N-His tag RG80844-NH
Aminoadipate aminotransferase cDNA ORF Clone, Rat, C-HA tag RG80844-CY
Aminoadipate aminotransferase cDNA ORF Clone, Rat, N-HA tag RG80844-NY
Aminoadipate aminotransferase cDNA ORF Clone, Rat, C-Myc tag RG80844-CM
Aminoadipate aminotransferase cDNA ORF Clone, Rat, N-Myc tag RG80844-NM
Aminoadipate aminotransferase qPCR Primer Pairs, Rat RP300808

Aminoadipate aminotransferase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Aminoadipate aminotransferase cDNA ORF Clone in Cloning Vector, Mouse MG52859-G
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, untagged MG52859-UT
Aminoadipate aminotransferase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52859-ACGLN
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52859-ACG
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52859-ANG
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52859-ACR
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52859-ANR
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52859-NF
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-His tag MG52859-CH
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, N-His tag MG52859-NH
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-HA tag MG52859-CY
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, N-HA tag MG52859-NY
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, C-Myc tag MG52859-CM
Aminoadipate aminotransferase cDNA ORF Clone, Mouse, N-Myc tag MG52859-NM

Aminoadipate aminotransferase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Aminoadipate aminotransferase cDNA ORF Clone in Cloning Vector, Human HG16667-U
Aminoadipate aminotransferase cDNA ORF Clone, Human, untagged HG16667-UT
Aminoadipate aminotransferase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16667-ACGLN
Aminoadipate aminotransferase cDNA ORF Clone, Human, C-GFPSpark® tag HG16667-ACG
Aminoadipate aminotransferase cDNA ORF Clone, Human, N-GFPSpark® tag HG16667-ANG
Aminoadipate aminotransferase cDNA ORF Clone, Human, C-OFPSpark® tag HG16667-ACR
Aminoadipate aminotransferase cDNA ORF Clone, Human, N-OFPSpark® tag HG16667-ANR
Aminoadipate aminotransferase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16667-CF
Aminoadipate aminotransferase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16667-NF
Aminoadipate aminotransferase cDNA ORF Clone, Human, C-His tag HG16667-CH
Aminoadipate aminotransferase cDNA ORF Clone, Human, N-His tag HG16667-NH
Aminoadipate aminotransferase cDNA ORF Clone, Human, C-HA tag HG16667-CY
Aminoadipate aminotransferase cDNA ORF Clone, Human, N-HA tag HG16667-NY
Aminoadipate aminotransferase cDNA ORF Clone, Human, C-Myc tag HG16667-CM
Aminoadipate aminotransferase cDNA ORF Clone, Human, N-Myc tag HG16667-NM
info info
添加购物车成功! 添加购物车失败!