6430573F11RIK cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

6430573F11RIK cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1344 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 6430573F11 gene with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

6430573F11RIK cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

Kiaa1456 cDNA ORF Clone, Mouse; TRM9L cDNA ORF Clone, Mouse

6430573F11RIK Background Information

Full Name
RIKEN cDNA 6430573F11 gene
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait