VISTA cDNA ORF Clone, Mouse, untagged

Cat: MG51550-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VISTA Reagents
CRO Services
Product recommended

All VISTA Reagents
VISTA cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse RIKEN cDNA 4632428N05 gene.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + XbaI (6.1kb + 0.93kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
VISTA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VISTA cDNA ORF Clone, Mouse, untagged Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
VISTA Background Information
Full Name
V-set immunoregulatory receptor

VISTA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VISTA cDNA ORF Clone in Cloning Vector, Rat RG81347-G

VISTA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VISTA cDNA ORF Clone in Cloning Vector, Mouse MG51550-G
VISTA cDNA ORF Clone, Mouse, untagged MG5A7629-UT
VISTA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7629-ACGLN
VISTA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51550-ACGLN
VISTA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51550-ACG
VISTA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51550-ACR
VISTA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51550-CF
VISTA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51550-NF
VISTA cDNA ORF Clone, Mouse, C-His tag MG51550-CH
VISTA cDNA ORF Clone, Mouse, N-His tag MG51550-NH
VISTA cDNA ORF Clone, Mouse, C-HA tag MG51550-CY
VISTA cDNA ORF Clone, Mouse, N-HA tag MG51550-NY
VISTA cDNA ORF Clone, Mouse, C-Myc tag MG51550-CM
VISTA cDNA ORF Clone, Mouse, N-Myc tag MG51550-NM
VISTA qPCR Primer Pairs, Mouse MP201434

VISTA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VISTA cDNA ORF Clone in Cloning Vector, Human HG13482-G
VISTA cDNA ORF Clone, Human, untagged HG13482-UT
VISTA cDNA ORF Clone, Human, C-GFPSpark® tag HG13482-ACG
VISTA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13482-ACGLN
VISTA cDNA ORF Clone, Human, C-OFPSpark® tag HG13482-ACR
VISTA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13482-CF
VISTA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13482-NF
VISTA cDNA ORF Clone, Human, C-His tag HG13482-CH
VISTA cDNA ORF Clone, Human, N-His tag HG13482-NH
VISTA cDNA ORF Clone, Human, C-HA tag HG13482-CY
VISTA cDNA ORF Clone, Human, N-HA tag HG13482-NY
VISTA cDNA ORF Clone, Human, C-Myc tag HG13482-CM
VISTA cDNA ORF Clone, Human, N-Myc tag HG13482-NM
VISTA qPCR Primer Pairs, Human HP102182
info info
添加购物车成功! 添加购物车失败!