After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD137L/4-1BBL/TNFSF9 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse TNFSF9 cDNA Clone Product Information
NCBI RefSeq:NM_009404.3
RefSeq ORF Size:930bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 9 with C terminal HA tag.
Gene Synonym:Ly63l, 4-1BBL, Cd137l, 4-1BB-L, AI848817, Tnfsf9
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

4-1BBL is the high affinity ligand of 4-1BB, also known as CD137L or TNFSF9. It is shown to be a type II surface glycoprotein belonging to the TNF superfamily. Expression of 4-1BBL is restricted to APCs, such as dendritic cells, macrophages, and activated B cells. Members of the TNF-TNF receptor superfamily have been shown to play critical roles in regulating cellular activation, differentiation and apoptosis. Several studies have reported that 4-1BBL/4-1BB interaction provided a co-stimulatory signal to T cells, and increased T cell proliferation and cytokines production. In additon, 4-1BBL is involved in cancers, infectious diseases and autoimmune diseases.

References
  • Cheung CT, (2007) Neutralizing anti-4-1BBL treatment improves cardiac function in viral myocarditis. Lab Invest. 87(7): 651-61.
  • Wang C, et al. (2009) Immune regulation by 4-1BB and 4-1BBL: complexities and challenges. Immunol Rev. 229(1): 192-215.
  • Habib-Agahi M, et al. (2009) 4-1BBL costimulation retrieves CD28 expression in activated T cells. Cell Immunol. 256(1-2): 39-46.
  • Size / Price
    Catalog: MG50067-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"