Matriptase/ST14 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10284-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Matriptase/ST14 Reagents
CRO Services

All Matriptase/ST14 Reagents
Matriptase/ST14 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2568 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the 1215C/T mutation not causing amino acid variation.
Description
Full length Clone DNA of Human suppression of tumorigenicity 14 (colon carcinoma) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 2.62kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Matriptase/ST14 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Matriptase/ST14 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Matriptase/ST14 Gene Expression validated Image 2400
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Matriptase/ST14 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ARCI11 cDNA ORF Clone, Human;HAI cDNA ORF Clone, Human;MT-SP1 cDNA ORF Clone, Human;MTSP1 cDNA ORF Clone, Human;PRSS14 cDNA ORF Clone, Human;SNC19 cDNA ORF Clone, Human;TADG15 cDNA ORF Clone, Human;TMPRSS14 cDNA ORF Clone, Human
Matriptase/ST14 Background Information
Full Name
suppression of tumorigenicity 14 (colon carcinoma)

Matriptase/ST14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Matriptase/ST14 cDNA ORF Clone in Cloning Vector, Mouse MG50521-M
Matriptase/ST14 cDNA ORF Clone, Mouse, untagged MG50521-UT
Matriptase/ST14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50521-ACG
Matriptase/ST14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50521-ACGLN
Matriptase/ST14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50521-ACR
Matriptase/ST14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50521-CF
Matriptase/ST14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50521-NF
Matriptase/ST14 cDNA ORF Clone, Mouse, C-His tag MG50521-CH
Matriptase/ST14 cDNA ORF Clone, Mouse, N-His tag MG50521-NH
Matriptase/ST14 cDNA ORF Clone, Mouse, C-HA tag MG50521-CY
Matriptase/ST14 cDNA ORF Clone, Mouse, N-HA tag MG50521-NY
Matriptase/ST14 cDNA ORF Clone, Mouse, C-Myc tag MG50521-CM
Matriptase/ST14 cDNA ORF Clone, Mouse, N-Myc tag MG50521-NM
Matriptase/ST14 qPCR Primer Pairs, Mouse MP200513

Matriptase/ST14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Matriptase/ST14 cDNA ORF Clone in Cloning Vector, Human HG10284-M
Matriptase/ST14 cDNA ORF Clone, Human, untagged HG10284-UT
Matriptase/ST14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10284-ACGLN
Matriptase/ST14 cDNA ORF Clone, Human, C-GFPSpark® tag HG10284-ACG
Matriptase/ST14 cDNA ORF Clone, Human, C-OFPSpark® tag HG10284-ACR
Matriptase/ST14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10284-CF
Matriptase/ST14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10284-NF
Matriptase/ST14 cDNA ORF Clone, Human, C-His tag HG10284-CH
Matriptase/ST14 cDNA ORF Clone, Human, N-His tag HG10284-NH
Matriptase/ST14 cDNA ORF Clone, Human, C-HA tag HG10284-CY
Matriptase/ST14 cDNA ORF Clone, Human, N-HA tag HG10284-NY
Matriptase/ST14 cDNA ORF Clone, Human, C-Myc tag HG10284-CM
Matriptase/ST14 cDNA ORF Clone, Human, N-Myc tag HG10284-NM
Matriptase/ST14 qPCR Primer Pairs, Human HP100329
info info
添加购物车成功! 添加购物车失败!