0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Mammalian Expression Vectors

Mammalian Expression Vectors

  • Selected tags: Myc, HA, FLAG, His
  • Designed for mammalian expression, stable or transient.
  • High protein expression level: CMV promoter & code optimization.
  • Hygromycin resistance gene for selection of stable cell lines.
  • 60% cost saving, start from $295.
  • pCMV / hygro - Myc
  • pCMV / hygro - HA
  • pCMV / hygro - FLAG
  • pCMV / hygro - His
  • pCMV / hygro

Physical Map

Vector Sequence
Download     

Description

 Vector Name  pCMV / hygro - Myc
 Vector Size  5684bp
 Vector Type  Mammalian Expression Vector
 Expression Method  Constitutive, Stable / Transient
 Promoter  CMV
 Antibiotic Resistance  Ampicillin
 Selection In Mammalian Cells  Hygromycin
 Protein Tag  Myc
 Sequencing Primer  Forward:T7(TAATACGACTCACTATAGGG)
 Reverse:BGH(TAGAAGGCACAGTCGAGG)

 

Schematic of pCMV / hygro - Myc Multiple Cloning Sites

Note: The Intrinsic signal peptide, if there is, will be used as default in construction.
Contact us if you would prefer to use the heterogeneous signal peptide (on the vector).