Product Catalog

Research Topics

Your Position: Home
> Mammalian Expression Vectors Mammalian Expression Vectors
- Selected tags: Myc, HA, FLAG, His
- Designed for mammalian expression, stable or transient.
- High protein expression level: CMV promoter & code optimization.
- Hygromycin resistance gene for selection of stable cell lines.
- 60% cost saving, start from $295.
- pCMV / hygro - Myc
- pCMV / hygro - HA
- pCMV / hygro - FLAG
- pCMV / hygro - His
- pCMV / hygro
Physical Map
Description
| Vector Name | pCMV / hygro - Myc |
| Vector Size | 5684bp |
| Vector Type | Mammalian Expression Vector |
| Expression Method | Constitutive, Stable / Transient |
| Promoter | CMV |
| Antibiotic Resistance | Ampicillin |
| Selection In Mammalian Cells | Hygromycin |
| Protein Tag | Myc |
| Sequencing Primer | Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG) |
Schematic of pCMV / hygro - Myc Multiple Cloning Sites

Note: The Intrinsic signal peptide, if there is, will be used as default in construction.
Contact us if you would prefer to use the heterogeneous signal peptide (on the vector).
+86-400-890-9989

