IGBF/PRSP cDNA ORF Clone, Human, C-DDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

IGBF/PRSP cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
345 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human microseminoprotein, beta, transcript variant PSP94 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.4kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IGBF/PRSP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGBF/PRSP cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

HPC13 cDNA ORF Clone, Human; IGBF cDNA ORF Clone, Human; MSP cDNA ORF Clone, Human; MSPB cDNA ORF Clone, Human; PN44 cDNA ORF Clone, Human; PRPS cDNA ORF Clone, Human; PSP cDNA ORF Clone, Human; PSP-94 cDNA ORF Clone, Human; PSP57 cDNA ORF Clone, Human; PSP94 cDNA ORF Clone, Human

IGBF/PRSP Background Information

Microseminoprotein-beta (MSMB) is a major secretory product from prostate epithelial cells. MSMB synthesis is decreased in prostate tumors in relation to tumor grade. MSMB levels are also reduced in the circulation and MSMB is therefore used as a serum biomarker for prostate cancer.MSMB gene have been associated with the risk of prostate cancer (PCa) in several independent genome-wide association studies.MSMB, a gene coding for beta-microseminoprotein, has been identified as a candidate susceptibility gene for prostate cancer (PrCa) in two genome-wide association studies (GWAS). A common variant, rs1993994, in the 5' region of the gene that encodes MSP (MSMB) has recently been identified as a risk factor for prostate cancer.
Full Name
microseminoprotein, beta-
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait