After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MMP2/MMP-2/CLG4A transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human MMP-2 cDNA Clone Product Information
NCBI RefSeq:NM_004530.4
RefSeq ORF Size:1983bp
cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V collagenase), transcript variant 1.
Gene Synonym:MMP2, CLG4, MONA, CLG4A, TBE-1, MMP-II
Restriction Site:HindIII + XhoI (5.5kb + 1.98kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for four point mutation of 750 C/T, 1149 T/C, 1380 G/A, 1806 C/T, none of which results in the encoded amino acid variation yet.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MMP-2 Gene Plasmid Map
Human MMP-2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human MMP2/MMP-2/CLG4A transcript variant 1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name

Matrix Metalloproteinase-2 (MMP-2) is an enzyme that degrades components of the extracellular matrix and thus plays a pivotal role in cell migration during physiological and pathological processes. MMP-2 expression is dependent on extracellular matrix metalloproteinase inducer (EMMPRIN), Her2/neu, growth factors, cytokines, and hormones. Pro-MMP-2 activation needs MT1-MMP and TIMP-2 contribution. MMP-2 is changed in distribution and increased in amount in the ventral cochlear nucleus after unilateral cochlear ablation. A low level of MMP-2 is linked to favorable prognosis in patients with a hormone receptor-negative tumor, usually associated with high risk. As a zymogen requiring proteolytic activation for catalytic activity, MMP-2 has been implicated broadly in the invasion and metastasis of many cancer model systems, including human breast cancer (HBC). Blocking MMP-2 secretion and activation during breast carcinoma development may decrease metastasis. The detection of active MMP-2 alone or the rate of pro-MMP-2 and active MMP-2 is considered a very sensitive indicator of cancer metastasis. Modulation of MMP-2 expression and activation through specific inhibitors and activators may thus provide a new mechanism for breast cancer treatment.

  • Thompson EW, et al. (1994) Collagen induced MMP-2 activation in human breast cancer. Breast Cancer Res Treat. 31(2-3): 357-70.
  • Jezierska A, et al. (2009) Matrix metalloproteinase-2 involvement in breast cancer progression: a mini-review. Med Sci Monit. 15(2): RA32-40.
  • Fredrich M, et al. (2010) MMP-2 is involved in synaptic remodeling after cochlear lesion. Neuroreport. 21(5): 324-7.
  • Size / Price
    Catalog: HG10082-M-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human MMP-2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.