MMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10082-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MMP-2 Reagents
CRO Services

All MMP-2 Reagents
MMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1983 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for four point mutation of 750 C/T, 1149 T/C, 1380 G/A, 1806 C/T, none of which results in the encoded amino acid variation yet.
Description
Full length Clone DNA of Human matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V collagenase), transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XhoI (5.5kb + 2.01kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MMP-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human MMP2/MMP-2/CLG4A Gene Expression validated Image 2366
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human 4E-BP1/EIF4EBP1 Gene Plasmid Map 7162
MMP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CLG4 cDNA ORF Clone, Human;CLG4A cDNA ORF Clone, Human;MMP-2 cDNA ORF Clone, Human;MMP-II cDNA ORF Clone, Human;MONA cDNA ORF Clone, Human;TBE-1 cDNA ORF Clone, Human
MMP-2 Background Information

Matrix Metalloproteinase-2 (MMP-2) is an enzyme that degrades components of the extracellular matrix and thus plays a pivotal role in cell migration during physiological and pathological processes. MMP-2 expression is dependent on extracellular matrix metalloproteinase inducer (EMMPRIN), Her2/neu, growth factors, cytokines, and hormones. Pro-MMP-2 activation needs MT1-MMP and TIMP-2 contribution. MMP-2 is changed in distribution and increased in amount in the ventral cochlear nucleus after unilateral cochlear ablation. A low level of MMP-2 is linked to favorable prognosis in patients with a hormone receptor-negative tumor, usually associated with high risk. As a zymogen requiring proteolytic activation for catalytic activity, MMP-2 has been implicated broadly in the invasion and metastasis of many cancer model systems, including human breast cancer (HBC). Blocking MMP-2 secretion and activation during breast carcinoma development may decrease metastasis. The detection of active MMP-2 alone or the rate of pro-MMP-2 and active MMP-2 is considered a very sensitive indicator of cancer metastasis. Modulation of MMP-2 expression and activation through specific inhibitors and activators may thus provide a new mechanism for breast cancer treatment.

Full Name
matrix metallopeptidase 2
References
  • Thompson EW, et al. (1994) Collagen induced MMP-2 activation in human breast cancer. Breast Cancer Res Treat. 31(2-3): 357-70.
  • Jezierska A, et al. (2009) Matrix metalloproteinase-2 involvement in breast cancer progression: a mini-review. Med Sci Monit. 15(2): RA32-40.
  • Fredrich M, et al. (2010) MMP-2 is involved in synaptic remodeling after cochlear lesion. Neuroreport. 21(5): 324-7.
  • info info
    添加购物车成功! 添加购物车失败!