Quick Order

DatasheetReviewsRelated ProductsProtocols
Human MMP-12 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human MMP-12 Gene Plasmid Map
Human MMP-12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Macrophage metalloelastase, also known as Matrix metalloproteinase-12, Macrophage elastase, MMP12, and MMP-12, is a secreted protein which belongs to the peptidase M10A family. MMP12 is a macrophage-secreted elastase that is highly induced in the liver and lung in response to S. mansoni eggs and contains four hemopexin-like domains. MMP12 is a proteolytic enzyme responsible for cleavage of plasminogen to angiotensin, which has an angiostatic effect. It may be involved in tissue injury and remodeling and has significant elastolytic activity. It may be related to prognosis in breast cancer patients. MMP12 promotes fibrosis by limiting the expression of specific ECM-degrading MMPs. Like MMP12, MMP13 expression is highly dependent on IL-13 and type I I-IL-4 receptor signaling. MMP12 is a potent proinflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by inflammation.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.