MMP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10266-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MMP12 Reagents
CRO Services

All MMP12 Reagents
MMP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 519 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human matrix metallopeptidase 12 (macrophage elastase) DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MMP12 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human MMP-12/MMP12 Gene Expression validated Image 2397
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
MMP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HME cDNA ORF Clone, Human;ME cDNA ORF Clone, Human;MME cDNA ORF Clone, Human;MMP-12 cDNA ORF Clone, Human
MMP12 Background Information

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Macrophage metalloelastase, also known as Matrix metalloproteinase-12, Macrophage elastase, MMP12, and MMP-12, is a secreted protein which belongs to the peptidase M10A family. MMP12 is a macrophage-secreted elastase that is highly induced in the liver and lung in response to S. mansoni eggs and contains four hemopexin-like domains. MMP12 is a proteolytic enzyme responsible for cleavage of plasminogen to angiotensin, which has an angiostatic effect. It may be involved in tissue injury and remodeling and has significant elastolytic activity. It may be related to prognosis in breast cancer patients. MMP12 promotes fibrosis by limiting the expression of specific ECM-degrading MMPs. Like MMP12, MMP13 expression is highly dependent on IL-13 and type I I-IL-4 receptor signaling. MMP12 is a potent proinflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by inflammation.

Full Name
matrix metallopeptidase 12
References
  • Shapiro S.D., et al.,(1993), Cloning and characterization of a unique elastolytic metalloproteinase produced by human alveolar macrophages. J. Biol. Chem. 268:23824-23829.
  • Gronski T.J. Jr., et al., (1997), Hydrolysis of a broad spectrum of extracellular matrix proteins by human macrophage elastase.J. Biol. Chem. 272:12189-12194.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • MMP12 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MMP12 cDNA ORF Clone, Mouse, untagged MG57494-UT
    MMP12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57494-ACG
    MMP12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57494-ACGLN
    MMP12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57494-ACR
    MMP12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57494-CF
    MMP12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57494-NF
    MMP12 cDNA ORF Clone, Mouse, C-His tag MG57494-CH
    MMP12 cDNA ORF Clone, Mouse, N-His tag MG57494-NH
    MMP12 cDNA ORF Clone, Mouse, C-HA tag MG57494-CY
    MMP12 cDNA ORF Clone, Mouse, N-HA tag MG57494-NY
    MMP12 cDNA ORF Clone, Mouse, C-Myc tag MG57494-CM
    MMP12 cDNA ORF Clone, Mouse, N-Myc tag MG57494-NM

    MMP12 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MMP12 cDNA ORF Clone in Cloning Vector, Human HG10266-M
    MMP12 cDNA ORF Clone, Human, untagged HG10266-UT
    MMP12 cDNA ORF Clone, Human, C-GFPSpark® tag HG10266-ACG
    MMP12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10266-ACGLN
    MMP12 cDNA ORF Clone, Human, C-OFPSpark® tag HG10266-ACR
    MMP12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10266-CF
    MMP12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10266-NF
    MMP12 cDNA ORF Clone, Human, C-His tag HG10266-CH
    MMP12 cDNA ORF Clone, Human, N-His tag HG10266-NH
    MMP12 cDNA ORF Clone, Human, C-HA tag HG10266-CY
    MMP12 cDNA ORF Clone, Human, N-HA tag HG10266-NY
    MMP12 cDNA ORF Clone, Human, C-Myc tag HG10266-CM
    MMP12 cDNA ORF Clone, Human, N-Myc tag HG10266-NM
    MMP12 qPCR Primer Pairs, Human HP100314
    info info
    添加购物车成功! 添加购物车失败!