Quick Order

Text Size:AAA

Human MAP2 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human METAP2 cDNA Clone Product Information
NCBI RefSeq:NM_006838.3
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Homo sapiens methionyl aminopeptidase 2 with Flag tag.
Gene Synonym:METAP2, p67, MAP2, MNPEP, p67eIF2
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-METAP2-flag
Restriction Site:KpnI + XhoI (5.4kb + 1.49kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

METAP2 (Methionine aminopeptidase 2), also known as MAP2 is a a protein which belongs to the peptidase M24A family. MAP2 binds 2 cobalt or manganese ions and contains approximately 12 O-linked N-acetylglucosamine (GlcNAc) residues. It is found in all organisms and is especially important because of its critical role in tissue repair and protein degradation. The catalytic activity of human MAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. MAP2 protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. It also plays a critical role in the regulation of protein synthesis.

References
  • Bennett, et al. (1997) EPR Studies on the Mono- and Dicobalt (II)-Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases. J Am Chem Soc. 119:1923-33.
  • Johansson, et al. (2008) Dicobalt II-II, II-III, and III-III Complexes as Spectroscopic Models for Dicobalt Enzyme Active Sites. Inorg Chem. 47:5079-92.
  • Bradshaw, et al. (2002) Aminopeptidases and angiogenesis. Essays Biochem. 38: 5-78.
  • Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"