Quick Order

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    MERS-CoV CoV-orf4b cDNA Clone Product Information
    NCBI RefSeq:JX869059.2
    RefSeq ORF Size:741bp
    cDNA Description:Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with N terminal His tag.
    Gene Synonym:CoV-orf4b
    Species:MERS-CoV
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:Identical with the Gene Bank AFS88939.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, N-His tag on other vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"