CSF1R cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10161-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CSF1R Reagents
CRO Services

All CSF1R Reagents
CSF1R cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2919 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations: 726 C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human colony stimulating factor 1receptor (CSF1R) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
BamHI + XbaI (5.4kb + 2.97kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CSF1R cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CSF1R cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C-FMS cDNA ORF Clone, Human;CD115 cDNA ORF Clone, Human;CSF-1R cDNA ORF Clone, Human;CSFR cDNA ORF Clone, Human;FIM2 cDNA ORF Clone, Human;FMS cDNA ORF Clone, Human;HDLS cDNA ORF Clone, Human;M-CSF-R cDNA ORF Clone, Human;MCSF Receptor cDNA ORF Clone, Human
CSF1R Background Information

M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the proliferation, differentiation, and activation of macrophages. This cell surface glycoprotein is consisted by an extracellular ligand-binding domain, a single membrane-spanning segment, and an intracellular tyrosine kinase domain. Binding of CSF1 activates the receptor kinase, leading to "autophosphorylation" of receptor subunits and the concomitant phosphorylation of a series of cellular proteins on tyrosine residues. CSF1R is a tyrosine kinase receptor that is absolutely required for macrophage differentiation and thus occupies a central role in hematopoiesis. CSF1 and its receptor (CSF1R, product of c-fms proto-oncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. This apparent role for CSF1/CSF1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer in which abnormal expression of CSF1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Tumor cell expression of CSF1R is under the control of several steroid hormones (glucocorticoids and progestins) and the binding of several bHLH transcription factors, while tumor cell expression of CSF-1 appears to be regulated by other hormones, some of which are involved in normal lactogenic differentiation. However, studies have demonstrated that CSF1 and CSF1R have additional roles in mammary gland development during pregnancy and lactation. The role of CSF1 and CSF1R in normal and neoplastic mammary development that may elucidate potential relationships of growth factor-induced biological changes in the breast during pregnancy and tumor progression.

Full Name
colony stimulating factor 1 receptor
References
  • Sherr CJ. (1990) The colony-stimulating factor 1 receptor: pleiotropy of signal-response coupling. Lymphokine Res. 9(4): 543-8.
  • Kacinski BM. (1997) CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol Reprod Dev. 46(1): 71-4.
  • Sapi E, et al. (1999) The role of CSF-1 in normal and neoplastic breast physiology. Proc Soc Exp Biol Med. 220(1): 1-8.
  • Sapi E. (2004) The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood). 229(1): 1-11.
  • Bonifer C, et al. (2008) The transcriptional regulation of the Colony-Stimulating Factor 1 Receptor (csf1r) gene during hematopoiesis. Front Biosci. 13: 549-60.
  • CSF1R cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CSF1R cDNA ORF Clone in Cloning Vector, Rhesus CG90035-G
    CSF1R cDNA ORF Clone, Rhesus, untagged CG90035-UT
    CSF1R cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90035-ACG
    CSF1R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90035-ACGLN
    CSF1R cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90035-ACR
    CSF1R cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90035-CF
    CSF1R cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90035-NF
    CSF1R cDNA ORF Clone, Rhesus, C-His tag CG90035-CH
    CSF1R cDNA ORF Clone, Rhesus, N-His tag CG90035-NH
    CSF1R cDNA ORF Clone, Rhesus, C-HA tag CG90035-CY
    CSF1R cDNA ORF Clone, Rhesus, N-HA tag CG90035-NY
    CSF1R cDNA ORF Clone, Rhesus, C-Myc tag CG90035-CM
    CSF1R cDNA ORF Clone, Rhesus, N-Myc tag CG90035-NM

    CSF1R cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CSF1R cDNA ORF Clone in Cloning Vector, Canine DG70086-G
    CSF1R cDNA ORF Clone, Canine, untagged DG70086-UT
    CSF1R cDNA ORF Clone, Canine, C-GFPSpark® tag DG70086-ACG
    CSF1R Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70086-ACGLN
    CSF1R cDNA ORF Clone, Canine, C-OFPSpark® tag DG70086-ACR
    CSF1R cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70086-CF
    CSF1R cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70086-NF
    CSF1R cDNA ORF Clone, Canine, C-His tag DG70086-CH
    CSF1R cDNA ORF Clone, Canine, N-His tag DG70086-NH
    CSF1R cDNA ORF Clone, Canine, C-HA tag DG70086-CY
    CSF1R cDNA ORF Clone, Canine, N-HA tag DG70086-NY
    CSF1R cDNA ORF Clone, Canine, C-Myc tag DG70086-CM
    CSF1R cDNA ORF Clone, Canine, N-Myc tag DG70086-NM

    CSF1R cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CSF1R cDNA ORF Clone in Cloning Vector, Mouse MG50059-M
    CSF1R cDNA ORF Clone, Mouse, untagged MG50059-UT
    CSF1R cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50059-ACG
    CSF1R Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50059-ACGLN
    CSF1R cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50059-ACR
    CSF1R cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50059-CF
    CSF1R cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50059-NF
    CSF1R cDNA ORF Clone, Mouse, C-His tag MG50059-CH
    CSF1R cDNA ORF Clone, Mouse, N-His tag MG50059-NH
    CSF1R cDNA ORF Clone, Mouse, C-HA tag MG50059-CY
    CSF1R cDNA ORF Clone, Mouse, N-HA tag MG50059-NY
    CSF1R cDNA ORF Clone, Mouse, C-Myc tag MG50059-CM
    CSF1R cDNA ORF Clone, Mouse, N-Myc tag MG50059-NM
    CSF1R qPCR Primer Pairs, Mouse MP200059

    CSF1R cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CSF1R cDNA ORF Clone in Cloning Vector, Human HG10161-M
    CSF1R cDNA ORF Clone, Human, untagged HG10161-UT
    CSF1R cDNA ORF Clone, Human, C-GFPSpark® tag HG10161-ACG
    CSF1R Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10161-ACGLN
    CSF1R cDNA ORF Clone, Human, C-OFPSpark® tag HG10161-ACR
    CSF1R cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10161-CF
    CSF1R cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10161-NF
    CSF1R cDNA ORF Clone, Human, C-His tag HG10161-CH
    CSF1R cDNA ORF Clone, Human, N-His tag HG10161-NH
    CSF1R cDNA ORF Clone, Human, C-HA tag HG10161-CY
    CSF1R cDNA ORF Clone, Human, N-HA tag HG10161-NY
    CSF1R cDNA ORF Clone, Human, C-Myc tag HG10161-CM
    CSF1R cDNA ORF Clone, Human, N-Myc tag HG10161-NM
    CSF1R qPCR Primer Pairs, Human HP100231
    info info
    添加购物车成功! 添加购物车失败!