After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human Tau cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human Tau Gene Plasmid Map
Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

MAPT (microtubule-associated protein tau) can produce tau proteins. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons of the central nervous system and are less common elsewhere, but are also expressed at very low levels in CNS astrocytes and oligodendrocytes. When tau proteins are defective, and no longer stabilize microtubules properly, they can result in dementias such as Alzheimer's disease. Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared to non-neuronal cells. One of tau's main functions is to modulate the stability of axonal microtubules. Other nervous system MAPs may perform similar functions, as suggested by tau knockout mice, who did not show abnormalities in brain development - possibly because of compensation in tau deficiency by other MAPs.

References
  • Harada A, et al. (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature. 369(6480):488-91.
  • Weingarten MD, et al. (1975) A protein factor essential for microtubule assembly. Proc Natl Acad Sci. 72(5):1858-62.
  • Goedert M, et al. (1989) Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 3(4): 519-26.
  • Images
    • Human MAPT / Tau transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"