Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human ERK5/BMK1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human ERK5/BMK1 Gene Plasmid Map
Human MAPK7 / ERK5 / BMK1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10024-ACG$245
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10024-ACR$245
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10024-ANG$245
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10024-ANR$245
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10024-CF$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG10024-CH$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10024-CM$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG10024-CY$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone in cloning vectorHG10024-M$75
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10024-M-F$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10024-NF$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG10024-NH$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10024-NM$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG10024-NY$215
Human ERK5/BMK1/MAPK7 transcript variant 3 Gene ORF cDNA clone expression plasmidHG10024-UT$215
 Learn more about expression Vectors
Product nameProduct name
Contact Us
  • Human MAPK7 / ERK5 / BMK1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.