Quick Order

Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid

  • Human MAPK14 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human MAPK14 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
( We provide with MAPK14 qPCR primers for gene expression analysis, HP100167 )
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:
Human MAPK14 Gene Plasmid Map
Human MAPK14 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10081-ACG$225
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10081-ACR$225
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10081-ANG$225
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10081-ANR$225
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10081-CF$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10081-CH$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10081-CM$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10081-CY$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10081-M$75
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10081-NF$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10081-NH$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10081-NM$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10081-NY$195
Human p38 alpha/MAPK14 transcript variant 2 Gene ORF cDNA clone expression plasmidHG10081-UT$195
 Learn more about expression Vectors
Product nameProduct name

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. MAPK14 can be detected in brain, heart, placenta, pancreas and skeletal muscle and it is expressed to a lesser extent in lung, liver and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. In respond to activation by environmental stress, pro-inflammatory cytokines and lipopolysaccharide, MAPK14 phosphorylates a number of transcription factors, such as ELK1 and ATF2 and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example IL-6. It may play a role in stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.

  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.