Quick Order

Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human ERK2 cDNA Clone Product Information
NCBI RefSeq:NM_002745.4
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 1 (MAPK1), transcript variant 1 with Flag tag.
Gene Synonym:MAPK1, ERK, p38, p40, p41, ERK2, ERT1, MAPK2, PRKM1, PRKM2, P42MAPK, p41mapk
Restriction Site:KpnI + XhoI (5.5kb + 1.11kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ERK2 Gene Plasmid Map
Human MAPK1 / ERK2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human ERK2 Gene Expression validated Image
Human MAPK1 / ERK2 transcript variant 1 natural ORF mammalian expression plasmid, Flag tag
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10030-ACG$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10030-ACR$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10030-ANG$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10030-ANR$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10030-CF$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10030-CH$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10030-CM$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10030-CY$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10030-M$75
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10030-NF$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10030-NH$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10030-NM$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10030-NY$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10030-UT$195
 Learn more about expression Vectors
Product nameProduct name

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.

  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.
  • Size / Price
    Catalog: HG10030-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human MAPK1 / ERK2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    • Human MAPK1 / ERK2 transcript variant 1 natural ORF mammalian expression plasmid, Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.