_×
Mouse MAP3K13 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Mouse MAP3K13 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Mouse MAP3K13 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Catalog Vector (Price) Quantity In Stock Operation
MG50831-G-M
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

MAP3K13 cDNA Clone Datasheet

 

MAP3K13 cDNA Clone Product Information

Gene Bank Ref.ID:

NM_172821.3

cDNA Size:

2910

Gene Synonym:

LZK; C130026N12Rik; Map3k13

Source: Mouse

MAP3K13 cDNA Clone Description

cDNA Description:

ORF Clone of Mus musculus mitogen-activated protein kinase kinase kinase 13 DNA.

Vector:

pCMV/hygro-Myc

Myc Tag Sequence: CAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description: Identical with the Gene Bank Ref.ID sequence except for two point mutations 1637 A/G resulting in the amino acid Lys substitution by Arg;1655 G/A resulting in the amino acid Arg substitution by Gln

MAP3K13 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

MAP3K13 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

MAP3K13 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGGCCAACC CTCAGGAGCA CCTGAGCTGC TCCTCTTTGC CACACTTGCC CTTGACTGAG
61       AACAAAACCT CTGGTGGACG AAATGAGCTT GCAGCTATGG GGAACCACCC TTCACCCAAG
121      CTCCCTGAGG ACCCTCAGGA GAGGGGGGCT ATACAGTCAG AGCTGATGGA GATCACAGGC
181      AGCCCGATCT CCACAACAGT GTTGACCAGT GTAAGCGAGG ATTCTAGGGG CCAGTTTGAG
241      AACAGTGTTC TTCAGCTAAG GGAACAGGAT GAGTCAGAGA TGACCCTGTC TCTGGGGAAC
301      AGCAACACTG TGGATGGAGA GAACACGAAC GGACCAGAAG ACATCAAGAT TCAGTTCAGC
361      AGGTCAGGCA GCGGCAGCGG CGGGTTTCTC GAAGGACTGT TTGGATGTCT CAGGCCCGTG
421      TGGAATATCA TTGGGAAGGC ATATTCCACT GATTACAAGC TGCAGCAGCA AGATACTTGG
481      GAAGTGCCAT TTGAGGAAAT CTCAGAGCTG CAATGGCTGG GTAGTGGAGC CCAAGGAGCT
541      GTCTTCCTGG GCAAATTCCG AGCAGAGGAG GTGGCCATCA AGAAGGTGAG AGAACAAAAT
601      GAGACGGACA TCAAGCATCT GAGGAAGCTG AAGCACCCTA ACATCATCGC CTTCAAGGGT
661      GTTTGCACTC AGGCCCCGTG CTACTGCATC ATCATGGAGT ACTGTGCCCA CGGACAGCTG
721      TACGAGGTCC TGAGAGCTGG CCGGAAGATC ACGCCCCGGC TGCTTGTGGA CTGGTCCACG
781      GGAATCGCCA GTGGAATGAA TTATCTCCAT CTCCACAAGA TTATACACCG TGACCTCAAG
841      TCGCCCAATG TTTTAGTGAC TCACACAGAT GCAGTGAAAA TTTCAGACTT TGGCACATCT
901      AAGGAACTCA GTGATAAAAG CACCAAGATG TCCTTCGCTG GCACCGTCGC GTGGATGGCA
961      CCAGAGGTGA TCCGGAATGA GCCTGTCTCG GAGAAGGTGG ACATATGGTC ATTTGGTGTG
1021     GTACTTTGGG AGCTGCTGAC AGGGGAGATT CCCTACAAGG ATGTGGACTC TTCCGCCATC
1081     ATTTGGGGTG TCGGCAGCAA CAGCTTGCAT CTCCCAGTTC CTTCCACTTG CCCGGATGGA
1141     TTCAAAATCC TTATGAAACA GACATGGCAG AGTAAGCCTC GCAACCGACC TTCTTTCAGG
1201     CAGACGCTCA TGCATCTGGA TATCGCGTCT GCAGATGTGC TCGCCACCCC TCAAGAAACT
1261     TACTTCAAGT CTCAGGCTGA ATGGAGAGAA GAAGTGAAGA AACATTTTGA GAAAATCAAA
1321     AGTGAAGGGA CCTGTATACA CCGATTAGAT GAAGAACTGA TTCGCCGGCG CAGGGAGGAG
1381     CTCAGGCATG CTCTGGATAT TCGGGAGCAC TACGAGAGAA AGCTCGAACG GGCTAACAAT
1441     CTGTACATGG AGCTGAGCGC CATCATGCTG CAGCTGGAGA TGCGCGAGAA GGAGCTCCTT
1501     AAGCGAGAGC AAGCAGTGGA AAAGAAGTAC CCTGGAACCT ACAAACGACA CCCTGTCCGT
1561     CCAATCATCC ACCCGAATGC CATGGAGAAA CTCATGAAAA GGAAGGGTGT GCCTCACAAG
1621     GCTGGGGTGC AGACTAGGCG GCCAGACCTG TTGCAATCCG AAGGCATTCC TAGTACAGAA
1681     GCGGTTCCCA CTGCATCCCC CCTGTCTGGA AGTCCCAAAA TGTCCACCGC AAGCAGCAGA
1741     AGCCGGTACC GAAGCAAACC ACGTCACCGC CGAGGGAACA GTAGAGGCAG CCATAGCGAC
1801     TTCGCAGCAA TCTTGAAAAC CCAGCCCGCC CAGGAAAATT CACCCCACCC CACCTACATG
1861     CACCACACTC AGGCTCAGTG CGCTTCAGTC CATCAACATA ACCCTCTCCA GCAGCAATAC
1921     CAGCAAATTC CTCCTGCCCA GCCTCAGAGC CGGCATCCCA GACTCAATGC GCATGGGCAG
1981     GACATTGCAA CCTGCGCCAA TAACCTGAGG TACTTTGGCC CCGCAGCGGC CCTGCGGAGT
2041     CCACTCAGCA ACCATGCACA AAGACAGATG CCTGGCTCAA GCCCCGACCT CATCTCCACA
2101     GCCATGGCTG CAGATTGGAG AAATTCTGAA CTTGATCAAG ACCAAGTTGG ACCCTGGGGC
2161     TGTTGTCAGG CTGAACCCTA TGATCCCTGT TTCCAGTGCA GGCCAGAACA TTCTGGGTCT
2221     TTAGATGTTC CCACTACTGA GCCAGTGGGG AGGAGCCCAG ACCTTTCCAG TTCACCAGCA
2281     CACAATCCTC TTTCAGGAAA TGCCCAAGGC TCTGAGAGAA CAGGGGCAAA TGGATTCAGT
2341     GGCTGTCAGT CTGGTATTTC TCATCAATTC ACACCCCCAA TGCTACCTCA GAAGACACGG
2401     CCCCTTCAGA AGAGTGGCGA TGACTCCTCA GAAGAGGAAG GGGAAGTGGA CAGTGAAGTA
2461     GAATTTCCTC GACGACAGAG GCCTCACCGC TGCATTAGCA GTTACCAGTC ATACTCAACC
2521     TTTAGCTCCG AGAACTTCTC TGTGTCTGAT GGAGAGGAGG GCAACACTAG TGACCACTCG
2581     AACAGTCCCG ATGAATCCGC CAACAGACGG CAGGACCGCC TGGCAGAGAC GCTGGACGAC
2641     CTGCTGTCTC AGACACCCGA GGCCCCCATC GAGATCTCCT CCCACTCAGA TGGGCTGTCT
2701     GACAAGGAGT GTGCTGTTCG GCGCGTGAAG ACACAGATGT CCCTAGGCAA GCTGTGTGCC
2761     GAGGAGCGCG GCTACGAGAA CCCTGTGCAG TTTGGAGACT CGGACTGTGA CTCTTCAGAG
2821     GGAGAGTGTT CCGATGCCAC AGTTAGGACC AGCAAGAACT ACAGCTCTGC CACCTGGGCT1
2881     GAGCAGAAAC TCATCTCAGA AGAGGATCTG2 TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. Myc Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"