Our new search engine has been lanuched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

Human LTBR/TNFRSF3 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human LTBR cDNA Clone Product Information
NCBI RefSeq:NM_002342.1
RefSeq ORF Size:1308bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3) with Flag tag.
Restriction Site:HindIII + XbaI (5.4kb + 1.36kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 516 A/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

LTBR (lymphotoxin beta receptor (TNFR superfamily, member 3)) is a member of the tumor necrosis factor (TNF) family of receptors. Tumor necrosis factor receptor is a trimeric cytokine receptor that binds tumor necrosis factors. The receptor cooperates with an adaptor protein (such as TRADD, TRAF, RIP), which is important in determining the outcome of the response. LTBR is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LTBR specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphtoxin-beta). LTBR and its ligand play a role in the development and organization of lymphoid tissue and tranformed cells. Activation of this protein can trigger apoptosis. Not only does the LTBR help trigger apoptosis, it can lead to the release of the cytokine interleukin 8. Overexpression of LTBR in HEK293 cells increases IL-8 promoter activity and leads to IL-8 release. It is also essential for development and organization of the secondary lymphoid organs and chemokine release.

  • Summers deLuca L, et al. (2011) A LTβR signaling in dendritic cells induces a type I IFN response that is required for optimal clonal expansion of CD8+ T cells. Proc Natl Acad Sci. 108(5):2046-51.
  • Bista P, et al. (2010) TRAF3 controls activation of the canonical and alternative NFkappaB by the lymphotoxin beta receptor. J Biol Chem. 285(17):12971-8.
  • Xu Y, et al. (2011) Adiponectin inhibits lymphotoxin-β receptor-mediated NF-κB signaling in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 404(4):1060-4.
  • Size / Price
    Catalog: HG10581-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.