_×
Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG11100-M-M
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

LRPAP1 cDNA Clone Datasheet

 

LRPAP1 cDNA Clone Product Information

Gene Bank Ref.ID:

NM_002337.2

cDNA Size:

1074

Gene Synonym:

RAP; MRAP; A2RAP; HBP44; A2MRAP; MGC138272

Source: Human

LRPAP1 cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens low density lipoprotein receptor-related protein associated protein 1 DNA.

Vector:

pCMV/hygro-Myc

Myc Tag Sequence: CAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

LRPAP1 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

LRPAP1 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

LRPAP1 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGGCGCCGC GGAGGGTCAG GTCGTTTCTG CGCGGGCTCC CGGCGCTGCT ACTGCTGCTG
61       CTCTTCCTCG GGCCCTGGCC CGCTGCGAGC CACGGCGGCA AGTACTCGCG GGAGAAGAAC
121      CAGCCCAAGC CGTCCCCGAA ACGCGAGTCC GGAGAGGAGT TCCGCATGGA GAAGTTGAAC
181      CAGCTGTGGG AGAAGGCCCA GCGACTGCAT CTTCCTCCCG TGAGGCTGGC CGAGCTCCAC
241      GCTGATCTGA AGATACAGGA GAGGGACGAA CTCGCCTGGA AGAAACTAAA GCTTGACGGC
301      TTGGACGAAG ATGGGGAGAA GGAAGCGAGA CTCATACGCA ACCTCAATGT CATCTTGGCC
361      AAGTATGGTC TGGACGGAAA GAAGGACGCT CGGCAGGTGA CCAGCAACTC CCTCAGTGGC
421      ACCCAGGAAG ACGGGCTGGA TGACCCCAGG CTGGAAAAGC TGTGGCACAA GGCGAAGACC
481      TCTGGGAAAT TCTCCGGCGA AGAACTGGAC AAGCTCTGGC GGGAGTTCCT GCATCACAAA
541      GAGAAAGTTC ACGAGTACAA CGTCCTGCTG GAGACCCTGA GCAGGACCGA AGAAATCCAC
601      GAGAACGTCA TTAGCCCCTC GGACCTGAGC GACATCAAGG GCAGCGTCCT GCACAGCAGG
661      CACACGGAGC TGAAGGAGAA GCTGCGCAGC ATCAACCAGG GCCTGGACCG CCTGCGCAGG
721      GTCAGCCACC AGGGCTACAG CACTGAGGCT GAGTTCGAGG AGCCCAGGGT GATTGACCTG
781      TGGGACCTGG CGCAGTCCGC CAACCTCACG GACAAGGAGC TGGAGGCGTT CCGGGAGGAG
841      CTCAAGCACT TCGAAGCCAA AATCGAGAAG CACAACCACT ACCAGAAGCA GCTGGAGATT
901      GCGCACGAGA AGCTGAGGCA CGCAGAGAGC GTGGGCGACG GCGAGCGTGT GAGCCGCAGC
961      CGCGAGAAGC ACGCCCTGCT GGAGGGGCGG ACCAAGGAGC TGGGCTACAC GGTGAAGAAG
1021     CATCTGCAGG ACCTGTCCGG CAGGATCTCC AGAGCTCGGC ACAACGAACT CGCT1GAGCAG
1081     AAACTCATCT CAGAAGAGGA TCTG2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. Myc Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"